• Journal of Environmental Health Sciences
• /
• v.42 no.3
• /
• pp.189-195
• /
• 2016

Objectives: To ensure the microbiological safety of groundwater, it was confirmed whether waterborne pathogenic bacteria in groundwater samples tested positive for total coliforms in the Chungcheongnam-do Province region. Methods: Total colony counts, total coliforms and fecal coliforms were tested according to the process mandated by the drinking water quality testing standards of Korea. DNA was extracted from the samples, tested positive for total coliforms, and then subjected to real-time PCR to detect waterborne pathogenic bacteria. Results: A total of 115 samples were inadequate for drinking water. Thirty-one cases (27%) showed positive for fecal coliforms and nine cases (7.8%) showed total colony counts exceeding drinking water standards. Twenty-seven cases (23.5%) showed three items (total colony counts, total coliforms and fecal coliforms). Using the real-time PCR method, waterborne pathogens were detected in 57 cases (49.6%) in 115 samples. Seventy-eight cases of waterborne pathogenic bacteria were detected (including duplications): 27 cases of pathogenic E. coli (EPEC (19), ETEC (5), EHEC (1), EAEC (1) and EIEC (1)); 45 of Bacillus cereus; two of Yersinia spp.; two of Salmonella spp.; one of Staphylococcus aureus; one of Clostridium perfringens. Conclusion: The real-time PCR method can offer rapid and accurate detection of waterborne pathogenic bacteria. Therefore, this assay could be an alternative to conventional culture methods and can further ensure the microbiological safety of groundwater.

• Journal of Environmental Science International
• /
• v.21 no.12
• /
• pp.1455-1462
• /
• 2012

The vertical distributions of nitrifying bacteria in aerobic fixed biofilm were investigated to evaluate the relationship between nitrification performance and microbial community at different HRT. Fluorescent in situ hybridization (FISH) and portable ion selective microelectrode system were adopted to analyze microbial communities and ions profiles according to the biofilm depth. Cilia media packed MLE (Modified Ludzack-Ettinger) like reactor composed of anoxic, aerobic I/II was operated with synthetic wastewater having COD 200 mg/L and $NH_4{^+}$-N mg/L at HRT of 6 hrs and 4 hrs. Total biofilm thickness of aerobic I, II reactor at 4 hrs condition was over two times than that of 6 hrs condition due to the sufficient substrate supply at 4 hrs condition (6 hrs; aerobic I 380 ${\mu}m$ and II 400 ${\mu}m$, 4 hrs; aerobic I 830 ${\mu}m$ and II 1040 ${\mu}m$). As deepen the biofilm detection point, the ratio of ammonia oxidizing bacteria (AOB) was decreased while the ratio of nitrite oxidizing bacteria (NOB) was maintained similar distribution at both HRT condition. The ratio of AOB was higher at 4 hrs than 6 hrs condition and $NH_4{^+}$-N removal efficiency was also higher at 4 hrs with 89.2% than 65.4% of 6 hrs. However, the ratio of NOB was decreased when HRT was reduced from 6 hrs to 4 hrs and $NO_2{^-}$-N accumulation was observed at 4 hrs condition. Therefore, it is considered that insufficient HRT condition could supply sufficient substrate and enrichment of AOB in all depth of fixed biofilm but cause decrease of NOB and nitrite accumulation.

• Journal of Animal Science and Technology
• /
• v.47 no.3
• /
• pp.465-474
• /
• 2005

A two-step broad-range PCR method detecting gram-negative bacteria at the level as low as 2 CFU was developed by using primers of GNFI and GNRI and then semi-nested primer of GNF2 and GNRI. The nucleotide sequences of the primers were determined based on l6S rRNA gene. The DNA fragments of 1173 bp and 169 bp were amplified in one-step PCRs with primer sets of GNFI-GNRI and GNF2-GNRl, respectively, using template DNA from seven strains of gram-negative bacteria including Escherichia coli, Enterobacter aerogenes, Klebsiella pneumoniae, Pseudomonas spp., and Acinetobacter baumaii but not from Achromobacter lyticus, Alca/igens faecalis, and five strains of gram-positive bacteria. DNA fragments of 180 bp were amplified from LTLT-pasteurized milk and UHf-pasteurized milk in the two-step PCR. The DNA fragments were amplified from LTLT-pasteurized milk which was added with Pseudomonas j/uorescens and subsequently heated at 65 $^{\circ}C$, 80 $^{\circ}C$, and 100 $^{\circ}C$ for 30 min but they were not amplified from the milk autoclaved at 121$^{\circ}C$ for 15 min. It was suggested in PCR that Pseudomonas fluorescens heated at 65 $^{\circ}C$ for 30 min in milk was more sensitive to DNase treatment than viable bacteria.

• Journal of the Korea Organic Resources Recycling Association
• /
• v.8 no.2
• /
• pp.146-153
• /
• 2000

To elucidate succession of bacterial populations, especially nitrifying bacteria during the composting of cattle manure with apple pomace, fluorescent in situ hybridization(FISH) using rRNA targeted oligonucleotide probes were applied. The density of ammonia-oxidizing bacteria was ranged from $3,3{\times}10^6cells/g$ dw to $13,4{\times}10^6cells/g$ dw with the peak value after 26 composting days whereas that of nitrite-oxidizing bacteria varied between $6.0{\times}10^6cells/g$ dw and $17.2{\times}10^6cells/g$ dw with the peak value after 7 composting days. And the tendency that the numbers of nitrite-oxidizing bacteria were higher than those of ammonia-oxidizing bacteria, and the peak-time of their densities were the same as that of data determined by the ratio of ammonia-oxidizing bacteria and nitrite-oxidizing bacteria to eubacteria. The peak of ammonia-oxidizing bacteria followed the peak of nitrite-oxidizing bacteria, at the late phase of composting process could be probably caused by the depletion of volatile ammonia of composting materials. Besides these results indicate that FISH method is a useful tool for detection of slow growing nitrifying bacteria.

• Journal of fish pathology
• /
• v.35 no.1
• /
• pp.47-56
• /
• 2022

Lincomycin as one of the lincosamides antibiotics have been mainly used in human and livestock fields, but have not been used in aquaculture. In this study, the distribution of minimum inhibitory concentration (MIC) values against lincomycin and the detection of the macrolide-lincosamide-streptogramin (MLS) resistance gene were confirmed in bacterial pathogens isolated from cultured olive flounder (Paralichthys olivaceus). Of the 107 strains isolated from Jeju, 36 strains of Gram-positive bacteria and 71 strains of Gram-negative bacteria were identified. Most of Streptococcus spp. was found to have a MIC value of less than or equal to 0.5 ㎍/mL, and Edwardsiella piscicida was found to have a MIC value higher than 1,024 ㎍/mL. V. harveyi and V. alginolyticus mostly showed MIC values of 256 ㎍/mL, but V. scophthalmi displayed values of 8~64 ㎍/mL. In the detection of MLS resistance gene, erm(B) was detected in 9 strains of Streptococcus spp., and erm(A) was confirmed in one strain.

• Journal of Environmental Health Sciences
• /
• v.36 no.2
• /
• pp.141-147
• /
• 2010

Indicator bacteria of fecal pollution were enumerated and compared by various detection methods for influent and final effluent of a sewage treatment plant. Total coliforms were enumerated by four methods including most probable numbers, chromogenic enzyme substrate test, membrane filtration, and plate counts and were about $10^4$ for influent and $10^2{\sim}10^3\;CFU/ml$ for final effluent. Fecal coliforms ranged between $10^3$ and $10^4$ for influent and $10^2\;CFU/ml$ for effluent by chromogenic enzyme substrate test and membrane filtration. Fecal streptococci counts were 1-log less than fecal coliforms counts, $10^2{\sim}10^3$ for influent and $10^1\;CFU/ml$ for effluent. Total coliforms numbers by plate count both in influent and in effluent showed 1-log higher than by the other three methods. Statistical analysis revealed that numbers of total coliforms by plate count in final effluent had the highest average of correlation (r=0.778, p<0.01) compared with those by the other three methods. In addition, total coliforms numbers by plate count showed most significant correlation (r=0.835, p<0.01) with those by chromogenic test which is well-known as its highest recovery efficiency. These results suggest that the plate count would be the optimum detection method for total coliforms in wastewater treatment plants which are the only microbiological standard of final effluent from wastewater treatment plants in the Republic of Korea, considering economic aspects and difficulties in laboratories.

• Korean Journal of Environmental Biology
• /
• v.19 no.4
• /
• pp.321-324
• /
• 2001

Groundwater samples were collected at 6 sites in Seoul area. DNA extraction from the sample was performed by the boiling method. Samples were boiled with guanidinium thyocyanate and phenol-chloroform. One set of primer was designed for amplification of 16S rDNA. For detection of denitrifying bacteria in groundwater sample, the author used primer sets consensus regions in gene sequences encoding the two forms of nitrite reductase (NIR), a key enzyme in the denitrification pathway. Two sets of PCR primer were designed to amplify $cd_1$-and Cu-nir. We confirmed the existence of denitrifying bacteria in 3 sites using $cd_1$-nir primer and in 4 sites using Cu-nir primer.

• The Journal of the Korea institute of electronic communication sciences
• /
• v.17 no.4
• /
• pp.715-722
• /
• 2022

If you don't regularly go to the dentist to check your teeth, it is difficult to notice cavities or various diseases of your teeth until you have pain or discomfort. Dental plaque is produced by the combination of food or foreign substances and bacteria in the mouth. Starch breaks down from the bacteria that form tartar. The acid that occurs at this time melts the enamel of the teeth and becomes a cavity. So tartar management is important. Poppyrin, the metabolism of bacteria in the mouth, reacts at 405 nm wavelengths and becomes red fluorescent, which can be seen by imaging through certain wavelength filters. By the above method, Frag and tartar are fluorescently detected and photographed with a yellow series of filters that pass wavelengths of 500 nm or more. It uses MATLAB to detect and display red fluorescence through image processing. Using the difference in voltage between normal teeth and tartar through an optical measuring circuit, it was connected to an Arduino and displayed on the LCD. This allows the user to know the presence and location of dental plaque more accurately.

• Journal of Korean Society of Environmental Engineers
• /
• v.32 no.6
• /
• pp.555-562
• /
• 2010

For the rapid and reliable detection of toxic compounds in water, a novel toxicity detection methodology based on sulfur-oxidizing bacteria (SOB) has been developed. The methodology exploits the ability of SOB to oxidize elemental sulfur to sulfuric acid in the presence of oxygen. The reaction results in an increase in electrical conductivity (EC) and a decrease in pH. Using a synthetic stream water (EC=0.12 mS/cm and pH=7.2), the baseline steady-state EC and pH values were 0.5~1.2 mS/cm and ~2.5 over 7 days of testing at HRT 30 minutes. When nitrite compounds were added to the system, the effluent EC decreased and the pH increased due to the inhibition of the SOB. Optimum HRT was 30 min and this HRT could be decresed by using smaller sulfur particles.

• Journal of Microbiology
• /
• v.39 no.1
• /
• pp.56-61
• /
• 2001

Plasmodiophora brassicae is an obligate parasite, a causal organism of clubroot disease in crucifers that can survive in the soil as resting spores for many years. P. brassicae causes great losses in susceptible varieties of crucifers throughout the world. In this present study, an in planta molecular marker for the detection of P. bassicae was developed using an oligonucleotide primer set foam the small subunit gene (18S like) and internal transcribed spacer (ITS) region of rDNA. The specific primer sequences determined were TCAGCTTGAATGCTAATGTG (ITS5) and CTACCTCATTTGAGATCCTTTGA (PB-2). This primer set was used to specifically detect p. bassicae in planta. The amplicon using the specific primer set was about 1,000 bp. However, the test plant and other soil-borne fungi including Fusarium spp. and Rhizoctonia app., as well as bacteria such as Pseudomonas app. and Erwinia sup. did not show any reaction with the primer set.