This study investigated the epidemiology of Listeria (L.) monocytogenes, a food-borne pathogen. The epidemiology of food-borne pathogens is of great importance for clarifying bacterial origin and preventing bacterial contamination and infection. This work examined 68 L. monocytogenes strains, including 11 reference strains and 57 isolates from imported US beef, domestic meats (beef, pork, chicken meat), raw milk, and milk plants. The random amplified polymorphic DNA (RAPD) techniques were optimized to develop a standard molecular epidemiological analysis of L. monocytogenes. There was great genetic variability among the isolates, which produced 24 and 34 RAPD patterns with primer HLWL85 and HLWL74, respectively. The discriminatory power of the RAPD methods with HLWL85 and HLWL74 primer were very high (DI = 0.957; S ${\geq}$ 80%, S ${\geq}$ 95%). Some RAPD types were specific to origin. A few RAPD types were specific for L. monocytogenes strains belonging to a particular serotype. Using the HLWL85 primer, the strains isolated from milk plants could be distinguished from the other strains. And using the HLWL74 primer, the strains isolated from imported beef (US) could be distinguished completely from the other strains.
This study focused on verifying the identification of freshwater fish species in Korea using Environmental DNA (eDNA) technique. The research of DNA is increasing in the field of ecology, since this is more sensitive of identify rather than traditional investigation method. Which is difficult to detect species hidden in water and be easily influenced by diverse factors (sites, bad weather, researchers and so on). We applied the pilot test in aquarium (Freshwater Fish Ecological Learning Center in Yangpyeong, Gyeonggi Do), where freshwater fish species are inhabits. We conducted to sampling and analyzing the sixteen water samples (50 species from 7 orders and 13 families) using MiFish primer set. The results showed that 45 species (90%) was investigated by eDNA. It highlight that eDNA with universal primer is possible to detect freshwater fish species of Korean. However, the errors on species identification seems to be caused by the primer that be not suited perfectly and the pollution such as aquarium, sampling collectors.
In this study we sought to determine the food fraud by discriminating species of commercial seafood product such as Larimichthys polyactis, Larimichthys crocea, Pennahia argentatus, and Miichthys miiuy, which are difficult to morphologically discriminate. After amplifying the mitochondrial cytochrome c oxidase subunit I gene of the reference fish, the DNA sequences of the amplified PCR products were analyzed. As a result, a 655 bp sequence for species identification was selected for use as DNA barcodes. To confirm the DNA data and primer set, the DNA barcode sequence of each fish was compared to that in that in the NCBI. All of the DNA barcode data were matched with the gene sequence of each fish in the NCBI. A total of 32 processed seafood products (8 L. polyactis, 12 L. crocea, 3 Pennahia argentatus, and 9 Miichthys miiuy) were investigated. Homology of 97% or more in DNA sequences was judged as the same species. As a result of the monitoring, there were no discovered cases of forgery or alteration. However, the use of a raw material name having no matching standard name in the Korea Food Code may cause consumer confusion. Therefore, it is suggested that the standard name or scientific name be co-labeled with the raw material name on seafood products to prevent consumer confusion.
Botrytis cinerea, gray mold pathogen, causes serious losses in greenhouse tomato crop. In this study, a primer set was developed for identification and specific PCR detection of B. cinerea from tomato plants. The primer pair (BTF1/BTR1) was designed from polymorphic sequence region in pyruvate carboxylase gene (pyc) of B. cinerea. A PCR product (112 bp) was amplified on genomic DNA of 13 B. cinerea isolates from 10 different host plants, but not on those from 6 other Botrytis spp., 4 Botryotinia spp., 5 Sclerotinia spp. and 16 other genus of phytopathogenic fungi. The sensitivity limit of the primer set was 2 pg of genomic DNA of B. cinerea, approximately. The PCR assay using species-specific primer set was specifically able to detect the pathogen on naturally infected tomato plants and artificially infected plants. These results suggest that the sensitivity and specificity of this primer set can be applied in a rapid and accurate diagnosis of tomato disease caused by B. cinerea.
The genetic variation and intraspecific relationships between 10 individuals of seven cultivars and one Ulleungdo native of Wasabia japonica were investigated using RAPD (Randomly Amplified Polymorphic DNA) analysis. The 21 primers out of 50 random primers were amplified for all tested plants. The 68 (47.2%) among 144 bands derived from 21 primers showed polymorphism, and 3.2 bands per primer were observed. Number of bands per primer was ranged from 2 to 13, and average numbers were 6.8. The phenograms for 11 analyzed individuals by RAPD markers were not matched well with those of the result by morphological characters since they were clustered monophyletic at the similarity coefficient value ranged from 0.81 to 0.96. The Ulleungdo native individual was clustered sister to Daruma, Simanesairal, Sawa, and Hujidaruma cultivars. The RAPD markers were not useful to evaluate the intraspecific variations in Wasabia japonica cultivars, therefore need to more specific molecular phylogenetic characters such as AFLP technology and gene sequence of nuclear and chloroplast DNA.
Genomic DNA from the blood of crucian carp(Carassius carassiu) from lake and aquaculture facility in Kunsan, Korea was extracted in order to identify genetic differences by polymerase chain reaction-randomly amplified polymorphic DNAs(PCR-RAPD). Out of 12 primers, 6 generated 266 highly reproducible RAPD markers, producing approximately 2.1 polymorphic bands per primer in crucian carp from lake. The degree of similarity varied from 0.18 to 0.76 as calculated by bandsharing analysis in crucian carp from lake. The RAPD outlines obtained with DNA of two different crucian carp populations from Kunsan were different(0.47 from lake and 0.70 from aquaculture facility, respectively). The electrophoretic analysis of polymerase chain reaction-randomly amplified polymorphic DNAs(PCR-RAPD) products showed high levels of similarity between different individuals in crucian carp from aquaculture facility. This result implies the genetic similarity due to raising in the same environmental condition or inbreeding within the crucian carp from aquaculture facility in Kunsan. In other words, crucian carp may have high levels of genome DNA diversity due to the introduction of the wild population from the other sites of Knsan even if it may be the geographical diverse distribution of this species. Generally, the RAPD polymorphism generated by these primers may be useful as a genetic marker for strain or population identification of important aquacultural fish species, crucian carp. However, in future, additional populations and sampling sites will be necessary to complement weak points.
Bacillus anthracis is a gram-positive spore-forming bacterium that causes the disease anthrax. In order to develop a DNA marker specific for Bacillus anthracis and to discriminate this species from Bacillus cereus group, we applied the randomly amplified polymorphic DNA (RAPD)-PCR technique to a collection of 29 strains of the genus Bacillus, including 22 species of the B. cereus group. A 709-bp RAPD marker (KHT5) specific for B. anthracis was obtained from B. anthracis BAK. The PCR product of internal primer set from the KHT5 fragment distinguished B. anthracis from the other species of the B. cereus group.
Bovine genome samples were collected from meat of three different beef breeds (Hanwoo, Holstein and imported beef breed) that are commercially merchandized in Korean beef market. Operon B (OPB)-kits were used as random primers (3, 7, 10, 11, 12, 14) in random amplified polymorphic DNA (RAPD) method on whole genome. Each primer provided characteristic bands that were highly polymorphic. Each single primer could provide relatively efficient polymorphic band patterns among breeds. However, use of two or more primers in combination is recommended to improve resolution of experiments with higher molecular weight bands of DNA. In our experiments, OPB-11 resolved well between beef cattle breeds and Holstein. And OPB-7, 12 and 14 could be combined with OPB-11 to identify Hanwoo beef from the other two kinds of beef.
DNA fingerprint patterns of 8 Brucella reference strains and 15 B. abortus field isolates were characterized by repetitive element sequence-based PCR (rep-PCR) using BOX- and ERIC-primers in this study. AMOS PCR differentiated all Brucella field isolates from B. abortus RB51, a vaccine strain by producing a B. abortus-specific 498 bp band. Rep-PCR using BOX-primer produced 13 to 18 bands with sizes of between 230 and 3,300 bp, and discriminated Brucella strains to the species level except B. canis and B. suis. PCR products amplified with ERIC primers were, however, not appropriate for differentiating the Brucella isolates. DNA fingerprint patterns for all B. abortus field isolates were identical among them and were put on one cluster with B. abortus biovar 1 reference strain in the dendrogram, indicating they were highly clonal. These results suggested that rep-PCR using BOX primer might to be a useful tool for calculating genetic relatedness among the Brucella species and for the study of brucellosis epidemiology.
Plasmodiophora brassicae is an obligate parasite, a causal organism of clubroot disease in crucifers that can survive in the soil as resting spores for many years. P. brassicae causes great losses in susceptible varieties of crucifers throughout the world. In this present study, an in planta molecular marker for the detection of P. bassicae was developed using an oligonucleotide primer set foam the small subunit gene (18S like) and internal transcribed spacer (ITS) region of rDNA. The specific primer sequences determined were TCAGCTTGAATGCTAATGTG (ITS5) and CTACCTCATTTGAGATCCTTTGA (PB-2). This primer set was used to specifically detect p. bassicae in planta. The amplicon using the specific primer set was about 1,000 bp. However, the test plant and other soil-borne fungi including Fusarium spp. and Rhizoctonia app., as well as bacteria such as Pseudomonas app. and Erwinia sup. did not show any reaction with the primer set.
본 웹사이트에 게시된 이메일 주소가 전자우편 수집 프로그램이나
그 밖의 기술적 장치를 이용하여 무단으로 수집되는 것을 거부하며,
이를 위반시 정보통신망법에 의해 형사 처벌됨을 유념하시기 바랍니다.
[게시일 2004년 10월 1일]
이용약관
제 1 장 총칙
제 1 조 (목적)
이 이용약관은 KoreaScience 홈페이지(이하 “당 사이트”)에서 제공하는 인터넷 서비스(이하 '서비스')의 가입조건 및 이용에 관한 제반 사항과 기타 필요한 사항을 구체적으로 규정함을 목적으로 합니다.
제 2 조 (용어의 정의)
① "이용자"라 함은 당 사이트에 접속하여 이 약관에 따라 당 사이트가 제공하는 서비스를 받는 회원 및 비회원을
말합니다.
② "회원"이라 함은 서비스를 이용하기 위하여 당 사이트에 개인정보를 제공하여 아이디(ID)와 비밀번호를 부여
받은 자를 말합니다.
③ "회원 아이디(ID)"라 함은 회원의 식별 및 서비스 이용을 위하여 자신이 선정한 문자 및 숫자의 조합을
말합니다.
④ "비밀번호(패스워드)"라 함은 회원이 자신의 비밀보호를 위하여 선정한 문자 및 숫자의 조합을 말합니다.
제 3 조 (이용약관의 효력 및 변경)
① 이 약관은 당 사이트에 게시하거나 기타의 방법으로 회원에게 공지함으로써 효력이 발생합니다.
② 당 사이트는 이 약관을 개정할 경우에 적용일자 및 개정사유를 명시하여 현행 약관과 함께 당 사이트의
초기화면에 그 적용일자 7일 이전부터 적용일자 전일까지 공지합니다. 다만, 회원에게 불리하게 약관내용을
변경하는 경우에는 최소한 30일 이상의 사전 유예기간을 두고 공지합니다. 이 경우 당 사이트는 개정 전
내용과 개정 후 내용을 명확하게 비교하여 이용자가 알기 쉽도록 표시합니다.
제 4 조(약관 외 준칙)
① 이 약관은 당 사이트가 제공하는 서비스에 관한 이용안내와 함께 적용됩니다.
② 이 약관에 명시되지 아니한 사항은 관계법령의 규정이 적용됩니다.
제 2 장 이용계약의 체결
제 5 조 (이용계약의 성립 등)
① 이용계약은 이용고객이 당 사이트가 정한 약관에 「동의합니다」를 선택하고, 당 사이트가 정한
온라인신청양식을 작성하여 서비스 이용을 신청한 후, 당 사이트가 이를 승낙함으로써 성립합니다.
② 제1항의 승낙은 당 사이트가 제공하는 과학기술정보검색, 맞춤정보, 서지정보 등 다른 서비스의 이용승낙을
포함합니다.
제 6 조 (회원가입)
서비스를 이용하고자 하는 고객은 당 사이트에서 정한 회원가입양식에 개인정보를 기재하여 가입을 하여야 합니다.
제 7 조 (개인정보의 보호 및 사용)
당 사이트는 관계법령이 정하는 바에 따라 회원 등록정보를 포함한 회원의 개인정보를 보호하기 위해 노력합니다. 회원 개인정보의 보호 및 사용에 대해서는 관련법령 및 당 사이트의 개인정보 보호정책이 적용됩니다.
제 8 조 (이용 신청의 승낙과 제한)
① 당 사이트는 제6조의 규정에 의한 이용신청고객에 대하여 서비스 이용을 승낙합니다.
② 당 사이트는 아래사항에 해당하는 경우에 대해서 승낙하지 아니 합니다.
- 이용계약 신청서의 내용을 허위로 기재한 경우
- 기타 규정한 제반사항을 위반하며 신청하는 경우
제 9 조 (회원 ID 부여 및 변경 등)
① 당 사이트는 이용고객에 대하여 약관에 정하는 바에 따라 자신이 선정한 회원 ID를 부여합니다.
② 회원 ID는 원칙적으로 변경이 불가하며 부득이한 사유로 인하여 변경 하고자 하는 경우에는 해당 ID를
해지하고 재가입해야 합니다.
③ 기타 회원 개인정보 관리 및 변경 등에 관한 사항은 서비스별 안내에 정하는 바에 의합니다.
제 3 장 계약 당사자의 의무
제 10 조 (KISTI의 의무)
① 당 사이트는 이용고객이 희망한 서비스 제공 개시일에 특별한 사정이 없는 한 서비스를 이용할 수 있도록
하여야 합니다.
② 당 사이트는 개인정보 보호를 위해 보안시스템을 구축하며 개인정보 보호정책을 공시하고 준수합니다.
③ 당 사이트는 회원으로부터 제기되는 의견이나 불만이 정당하다고 객관적으로 인정될 경우에는 적절한 절차를
거쳐 즉시 처리하여야 합니다. 다만, 즉시 처리가 곤란한 경우는 회원에게 그 사유와 처리일정을 통보하여야
합니다.
제 11 조 (회원의 의무)
① 이용자는 회원가입 신청 또는 회원정보 변경 시 실명으로 모든 사항을 사실에 근거하여 작성하여야 하며,
허위 또는 타인의 정보를 등록할 경우 일체의 권리를 주장할 수 없습니다.
② 당 사이트가 관계법령 및 개인정보 보호정책에 의거하여 그 책임을 지는 경우를 제외하고 회원에게 부여된
ID의 비밀번호 관리소홀, 부정사용에 의하여 발생하는 모든 결과에 대한 책임은 회원에게 있습니다.
③ 회원은 당 사이트 및 제 3자의 지적 재산권을 침해해서는 안 됩니다.
제 4 장 서비스의 이용
제 12 조 (서비스 이용 시간)
① 서비스 이용은 당 사이트의 업무상 또는 기술상 특별한 지장이 없는 한 연중무휴, 1일 24시간 운영을
원칙으로 합니다. 단, 당 사이트는 시스템 정기점검, 증설 및 교체를 위해 당 사이트가 정한 날이나 시간에
서비스를 일시 중단할 수 있으며, 예정되어 있는 작업으로 인한 서비스 일시중단은 당 사이트 홈페이지를
통해 사전에 공지합니다.
② 당 사이트는 서비스를 특정범위로 분할하여 각 범위별로 이용가능시간을 별도로 지정할 수 있습니다. 다만
이 경우 그 내용을 공지합니다.
제 13 조 (홈페이지 저작권)
① NDSL에서 제공하는 모든 저작물의 저작권은 원저작자에게 있으며, KISTI는 복제/배포/전송권을 확보하고
있습니다.
② NDSL에서 제공하는 콘텐츠를 상업적 및 기타 영리목적으로 복제/배포/전송할 경우 사전에 KISTI의 허락을
받아야 합니다.
③ NDSL에서 제공하는 콘텐츠를 보도, 비평, 교육, 연구 등을 위하여 정당한 범위 안에서 공정한 관행에
합치되게 인용할 수 있습니다.
④ NDSL에서 제공하는 콘텐츠를 무단 복제, 전송, 배포 기타 저작권법에 위반되는 방법으로 이용할 경우
저작권법 제136조에 따라 5년 이하의 징역 또는 5천만 원 이하의 벌금에 처해질 수 있습니다.
제 14 조 (유료서비스)
① 당 사이트 및 협력기관이 정한 유료서비스(원문복사 등)는 별도로 정해진 바에 따르며, 변경사항은 시행 전에
당 사이트 홈페이지를 통하여 회원에게 공지합니다.
② 유료서비스를 이용하려는 회원은 정해진 요금체계에 따라 요금을 납부해야 합니다.
제 5 장 계약 해지 및 이용 제한
제 15 조 (계약 해지)
회원이 이용계약을 해지하고자 하는 때에는 [가입해지] 메뉴를 이용해 직접 해지해야 합니다.
제 16 조 (서비스 이용제한)
① 당 사이트는 회원이 서비스 이용내용에 있어서 본 약관 제 11조 내용을 위반하거나, 다음 각 호에 해당하는
경우 서비스 이용을 제한할 수 있습니다.
- 2년 이상 서비스를 이용한 적이 없는 경우
- 기타 정상적인 서비스 운영에 방해가 될 경우
② 상기 이용제한 규정에 따라 서비스를 이용하는 회원에게 서비스 이용에 대하여 별도 공지 없이 서비스 이용의
일시정지, 이용계약 해지 할 수 있습니다.
제 17 조 (전자우편주소 수집 금지)
회원은 전자우편주소 추출기 등을 이용하여 전자우편주소를 수집 또는 제3자에게 제공할 수 없습니다.
제 6 장 손해배상 및 기타사항
제 18 조 (손해배상)
당 사이트는 무료로 제공되는 서비스와 관련하여 회원에게 어떠한 손해가 발생하더라도 당 사이트가 고의 또는 과실로 인한 손해발생을 제외하고는 이에 대하여 책임을 부담하지 아니합니다.
제 19 조 (관할 법원)
서비스 이용으로 발생한 분쟁에 대해 소송이 제기되는 경우 민사 소송법상의 관할 법원에 제기합니다.
[부 칙]
1. (시행일) 이 약관은 2016년 9월 5일부터 적용되며, 종전 약관은 본 약관으로 대체되며, 개정된 약관의 적용일 이전 가입자도 개정된 약관의 적용을 받습니다.