• Korean Journal of Veterinary Research
• /
• v.49 no.4
• /
• pp.319-328
• /
• 2009

This study investigated the epidemiology of Listeria (L.) monocytogenes, a food-borne pathogen. The epidemiology of food-borne pathogens is of great importance for clarifying bacterial origin and preventing bacterial contamination and infection. This work examined 68 L. monocytogenes strains, including 11 reference strains and 57 isolates from imported US beef, domestic meats (beef, pork, chicken meat), raw milk, and milk plants. The random amplified polymorphic DNA (RAPD) techniques were optimized to develop a standard molecular epidemiological analysis of L. monocytogenes. There was great genetic variability among the isolates, which produced 24 and 34 RAPD patterns with primer HLWL85 and HLWL74, respectively. The discriminatory power of the RAPD methods with HLWL85 and HLWL74 primer were very high (DI = 0.957; S ${\geq}$ 80%, S ${\geq}$ 95%). Some RAPD types were specific to origin. A few RAPD types were specific for L. monocytogenes strains belonging to a particular serotype. Using the HLWL85 primer, the strains isolated from milk plants could be distinguished from the other strains. And using the HLWL74 primer, the strains isolated from imported beef (US) could be distinguished completely from the other strains.

• Journal of Environmental Impact Assessment
• /
• v.30 no.1
• /
• pp.1-12
• /
• 2021

This study focused on verifying the identification of freshwater fish species in Korea using Environmental DNA (eDNA) technique. The research of DNA is increasing in the field of ecology, since this is more sensitive of identify rather than traditional investigation method. Which is difficult to detect species hidden in water and be easily influenced by diverse factors (sites, bad weather, researchers and so on). We applied the pilot test in aquarium (Freshwater Fish Ecological Learning Center in Yangpyeong, Gyeonggi Do), where freshwater fish species are inhabits. We conducted to sampling and analyzing the sixteen water samples (50 species from 7 orders and 13 families) using MiFish primer set. The results showed that 45 species (90%) was investigated by eDNA. It highlight that eDNA with universal primer is possible to detect freshwater fish species of Korean. However, the errors on species identification seems to be caused by the primer that be not suited perfectly and the pollution such as aquarium, sampling collectors.

• Journal of Food Hygiene and Safety
• /
• v.35 no.6
• /
• pp.574-580
• /
• 2020

In this study we sought to determine the food fraud by discriminating species of commercial seafood product such as Larimichthys polyactis, Larimichthys crocea, Pennahia argentatus, and Miichthys miiuy, which are difficult to morphologically discriminate. After amplifying the mitochondrial cytochrome c oxidase subunit I gene of the reference fish, the DNA sequences of the amplified PCR products were analyzed. As a result, a 655 bp sequence for species identification was selected for use as DNA barcodes. To confirm the DNA data and primer set, the DNA barcode sequence of each fish was compared to that in that in the NCBI. All of the DNA barcode data were matched with the gene sequence of each fish in the NCBI. A total of 32 processed seafood products (8 L. polyactis, 12 L. crocea, 3 Pennahia argentatus, and 9 Miichthys miiuy) were investigated. Homology of 97% or more in DNA sequences was judged as the same species. As a result of the monitoring, there were no discovered cases of forgery or alteration. However, the use of a raw material name having no matching standard name in the Korea Food Code may cause consumer confusion. Therefore, it is suggested that the standard name or scientific name be co-labeled with the raw material name on seafood products to prevent consumer confusion.

• The Korean Journal of Mycology
• /
• v.36 no.2
• /
• pp.138-143
• /
• 2008

Botrytis cinerea, gray mold pathogen, causes serious losses in greenhouse tomato crop. In this study, a primer set was developed for identification and specific PCR detection of B. cinerea from tomato plants. The primer pair (BTF1/BTR1) was designed from polymorphic sequence region in pyruvate carboxylase gene (pyc) of B. cinerea. A PCR product (112 bp) was amplified on genomic DNA of 13 B. cinerea isolates from 10 different host plants, but not on those from 6 other Botrytis spp., 4 Botryotinia spp., 5 Sclerotinia spp. and 16 other genus of phytopathogenic fungi. The sensitivity limit of the primer set was 2 pg of genomic DNA of B. cinerea, approximately. The PCR assay using species-specific primer set was specifically able to detect the pathogen on naturally infected tomato plants and artificially infected plants. These results suggest that the sensitivity and specificity of this primer set can be applied in a rapid and accurate diagnosis of tomato disease caused by B. cinerea.

• Korean Journal of Medicinal Crop Science
• /
• v.12 no.1
• /
• pp.31-35
• /
• 2004

The genetic variation and intraspecific relationships between 10 individuals of seven cultivars and one Ulleungdo native of Wasabia japonica were investigated using RAPD (Randomly Amplified Polymorphic DNA) analysis. The 21 primers out of 50 random primers were amplified for all tested plants. The 68 (47.2%) among 144 bands derived from 21 primers showed polymorphism, and 3.2 bands per primer were observed. Number of bands per primer was ranged from 2 to 13, and average numbers were 6.8. The phenograms for 11 analyzed individuals by RAPD markers were not matched well with those of the result by morphological characters since they were clustered monophyletic at the similarity coefficient value ranged from 0.81 to 0.96. The Ulleungdo native individual was clustered sister to Daruma, Simanesairal, Sawa, and Hujidaruma cultivars. The RAPD markers were not useful to evaluate the intraspecific variations in Wasabia japonica cultivars, therefore need to more specific molecular phylogenetic characters such as AFLP technology and gene sequence of nuclear and chloroplast DNA.

• Development and Reproduction
• /
• v.5 no.2
• /
• pp.151-158
• /
• 2001

Genomic DNA from the blood of crucian carp(Carassius carassiu) from lake and aquaculture facility in Kunsan, Korea was extracted in order to identify genetic differences by polymerase chain reaction-randomly amplified polymorphic DNAs(PCR-RAPD). Out of 12 primers, 6 generated 266 highly reproducible RAPD markers, producing approximately 2.1 polymorphic bands per primer in crucian carp from lake. The degree of similarity varied from 0.18 to 0.76 as calculated by bandsharing analysis in crucian carp from lake. The RAPD outlines obtained with DNA of two different crucian carp populations from Kunsan were different(0.47 from lake and 0.70 from aquaculture facility, respectively). The electrophoretic analysis of polymerase chain reaction-randomly amplified polymorphic DNAs(PCR-RAPD) products showed high levels of similarity between different individuals in crucian carp from aquaculture facility. This result implies the genetic similarity due to raising in the same environmental condition or inbreeding within the crucian carp from aquaculture facility in Kunsan. In other words, crucian carp may have high levels of genome DNA diversity due to the introduction of the wild population from the other sites of Knsan even if it may be the geographical diverse distribution of this species. Generally, the RAPD polymorphism generated by these primers may be useful as a genetic marker for strain or population identification of important aquacultural fish species, crucian carp. However, in future, additional populations and sampling sites will be necessary to complement weak points.

• Korean Journal of Microbiology
• /
• v.39 no.1
• /
• pp.40-44
• /
• 2003

Bacillus anthracis is a gram-positive spore-forming bacterium that causes the disease anthrax. In order to develop a DNA marker specific for Bacillus anthracis and to discriminate this species from Bacillus cereus group, we applied the randomly amplified polymorphic DNA (RAPD)-PCR technique to a collection of 29 strains of the genus Bacillus, including 22 species of the B. cereus group. A 709-bp RAPD marker (KHT5) specific for B. anthracis was obtained from B. anthracis BAK. The PCR product of internal primer set from the KHT5 fragment distinguished B. anthracis from the other species of the B. cereus group.

• Asian-Australasian Journal of Animal Sciences
• /
• v.14 no.12
• /
• pp.1655-1658
• /
• 2001

Bovine genome samples were collected from meat of three different beef breeds (Hanwoo, Holstein and imported beef breed) that are commercially merchandized in Korean beef market. Operon B (OPB)-kits were used as random primers (3, 7, 10, 11, 12, 14) in random amplified polymorphic DNA (RAPD) method on whole genome. Each primer provided characteristic bands that were highly polymorphic. Each single primer could provide relatively efficient polymorphic band patterns among breeds. However, use of two or more primers in combination is recommended to improve resolution of experiments with higher molecular weight bands of DNA. In our experiments, OPB-11 resolved well between beef cattle breeds and Holstein. And OPB-7, 12 and 14 could be combined with OPB-11 to identify Hanwoo beef from the other two kinds of beef.

• Korean Journal of Veterinary Research
• /
• v.45 no.2
• /
• pp.199-205
• /
• 2005

DNA fingerprint patterns of 8 Brucella reference strains and 15 B. abortus field isolates were characterized by repetitive element sequence-based PCR (rep-PCR) using BOX- and ERIC-primers in this study. AMOS PCR differentiated all Brucella field isolates from B. abortus RB51, a vaccine strain by producing a B. abortus-specific 498 bp band. Rep-PCR using BOX-primer produced 13 to 18 bands with sizes of between 230 and 3,300 bp, and discriminated Brucella strains to the species level except B. canis and B. suis. PCR products amplified with ERIC primers were, however, not appropriate for differentiating the Brucella isolates. DNA fingerprint patterns for all B. abortus field isolates were identical among them and were put on one cluster with B. abortus biovar 1 reference strain in the dendrogram, indicating they were highly clonal. These results suggested that rep-PCR using BOX primer might to be a useful tool for calculating genetic relatedness among the Brucella species and for the study of brucellosis epidemiology.

• Journal of Microbiology
• /
• v.39 no.1
• /
• pp.56-61
• /
• 2001

Plasmodiophora brassicae is an obligate parasite, a causal organism of clubroot disease in crucifers that can survive in the soil as resting spores for many years. P. brassicae causes great losses in susceptible varieties of crucifers throughout the world. In this present study, an in planta molecular marker for the detection of P. bassicae was developed using an oligonucleotide primer set foam the small subunit gene (18S like) and internal transcribed spacer (ITS) region of rDNA. The specific primer sequences determined were TCAGCTTGAATGCTAATGTG (ITS5) and CTACCTCATTTGAGATCCTTTGA (PB-2). This primer set was used to specifically detect p. bassicae in planta. The amplicon using the specific primer set was about 1,000 bp. However, the test plant and other soil-borne fungi including Fusarium spp. and Rhizoctonia app., as well as bacteria such as Pseudomonas app. and Erwinia sup. did not show any reaction with the primer set.