• 한국환경과학회지
• /
• 제33권1호
• /
• pp.27-41
• /
• 2024

In this study, we evaluated productivity, soil physiochemical properties, and soil microbial characteristics in Kimchi cabbage(Brassica rapa subsp. pekinensis) cultivation within a highland environment during summer. Specifically, we examined the effect of different cropping systems, namely monoculture and rotation with soybean, over an 8-year cropping period. The results of our investigation revealed that significant differences were absent in terms of yield and soil physiochemical properties between the two cropping systems. However, microbial characteristics exhibited distinctive patterns. Bacterial diversity was significantly higher in the rotation system that in the monoculture, whereas fungal diversity demonstrated a preference for rotation although the result was not significant. Our findings identified the presence of Bradyrhizobium stylosanthis, a nitrogen-fixation symbiont, as an indicator ASV (amplicon sequence variant) in the rotation system, where it displayed significantly higher abundances. These observations suggest a potential positive effect of the rotation system on nitrogen fixation. Notably, throughout the cultivation period, both cropping systems did not exhibit critical disease incidences. However, Fusarium oxysporum, a well-known pathogen responsible for inducing fusarium wilt disease in Kimchi cabbage, was detected with significantly higher abundance in the monoculture system. This finding raises concerns about the potential risk associated with Kimchi cabbage cultivation in a long-term monoculture system.

• 환경생물
• /
• 제39권3호
• /
• pp.329-335
• /
• 2021

2017년 이후 강원도 고랭지배추는 클로버씨스트선충에 의한 피해를 받아 왔다. 저항성 배추 품종 재배는 씨스트선충 피해를 줄일 수 있는 가장 경제적인 방제 방법이다. 본 연구에서는 클로버씨스트선충 저항성 배추 신품종 육성을 위한 육종 소재 탐색을 위해 배추류 유전자원 총 57자원을 대상으로 클로버씨스트선충에 대한 저항성 검정을 수행하였다. 배추(Brassica rapa subsp. pekinensis), 순무(B. rapa), Brassica sp., 갓(B. juncea), 겨자류(B. carinata, B. tournefortii), 경수채(B. rapa subsp. nipposinica), 다채(B. rapasubsp. narinosa), 평지(B. rapa var. perviridis), 루타바가(B. napus var. napobrassica), 로켓샐러드(Eruca sativa) 54자원은 뿌리에 클로버씨스트선충 암컷이 300개 이상 증식되어 매우 감수성인 것으로 나타났다. 겨자류 2자원(B. carinata, B. tournefortii)도 클로버씨스트선충 암컷이 각각 144개, 110개 증식되어 감수성인 것으로 나타났다. 반면, 겨자류 중에서 African mustard (B. tournefortii, 씨앗은행 관리번호 IT218058)는 클로버씨스트선충 암컷이 평균 4±1.8로 증식되어 저항성인 배추류 유전자원인 것으로 나타났다. 본 연구에서 선발된 African mustard (IT218058)는 클로버씨스트선충 저항성 배추 품종 육성을 위한 육종 소재로 활용 가능할 것으로 판단된다.

• 농약과학회지
• /
• 제18권4호
• /
• pp.364-375
• /
• 2014

소면적 재배작물 약효, 약해시험 그룹화를 위하여 소면적 재배작물 중 국내에 재배되는 엽채류 중 종류가 많고 재배면적이 비교적 큰 국화과 및 십자화과 작물인 상추, 잎브로콜리, 치커리, 배추, 열무, 유채, 쑥갓, 우엉, 앤디브, 겨자를 선정하여 십자화과 및 국화과에 공통으로 발생하는 병해충에 대한 포장시험 및 국내외 약효 시험성적을 비교검토 하였다. 국화과 및 십자화과 소면적 재배작물에 발생하는 흰가루병, 잿빛곰팡이병, 균핵병, 노균병, 무름병, 파밤나방, 도둑나방, 무테두리진딧물, 배추흰나비, 배추좀나방, 아메리카잎굴파리에 대한 약효시험 및 자료분석 결과에서도 기주 작물은 다르더라도 병해충이 동일종이면 방제효과가 유사한 경향으로 나타나는 것으로 보아 약효시험을 생략해도 될 가능성이 높아 국내 소면적 작물을 과별로 분류하고 동일 병원균을 대상으로 약효 외삽이 가능한 작물들을 분류한 후 작물잔류 상호적용 작물 그룹과의 연계를 검토하면 약효시험 및 잔류성 시험생략 후 약해시험만으로 간략히 적용하는 방안을 마련할 수 있을 것이다.

• Food Science and Biotechnology
• /
• 제14권4호
• /
• pp.466-469
• /
• 2005

Chinese cabbage (Brassica campestris L. Pekinensis) is Brassica vegetable that contains high amounts of glucosinolates. Glucosinolates and their breakdown products are thought to contribute to health promotion by preventing some cancers. Chinese cabbage is the most commonly consumed vegetable in Asian countries including Korea. In this study, qualitative and quantitative analyses of 3-butenyl glucosinolate (Gluconapin) from different cultivars and different parts of the cabbage were performed. Gluconapin of Chinese cabbage was extracted by hot ethanol ($80^{\circ}C$), isolated by an anion exchange column and identified by GC/MS and LC/MS. The levels of glucosinolates in Chinese cabbage varied according to the different parts, cultivars, and blanching time. In general, the concentrations of 3-butenyl isothiocyanate (ITC) were higher in the leaf than in the midribs parts. The cultivar 'Bulam no. 3' had a much greater content of 3-butenyl ITC than the cultivar 'Garak no. 1,' and the levels of butenyl ITC were highest after two weeks of storage. Blanching treatment decreased the concentration of 3-butenyl ITC. The ITC concentration varied extensively among different crops of the same species, and according to the different parts on the cabbage, the storage duration and the boiling time.

• Animal cells and systems
• /
• 제9권4호
• /
• pp.239-244
• /
• 2005

A cDNA clone for a wound- and pathogen-induced gene in Chinese cabbage (Brassica rapa subsp. pekinensis) was isolated and characterized. The cabbage gene, designated BrPR4, encodes a pathogenesis-related protein 4 (PR4) of 140 amino acids. The BrPR4 protein shows high similarity with wound-inducible antifungal proteins of tobacco, potato, barley, and wheat. The BrPR4 gene is locally induced by a nonhost pathogen, Pseudomonas syringae pv. tomato, that elicits a hypersensitive response in Chinese cabbage. Treatment of the cabbage leaves with benzothiadiazole (BTH), methyl jasmonate or ethephon showed that the BrPR4 gene expression is strongly induced by ethylene, but not by methyl jasmonate or BTH. The BrPR4 gene is also activated by wounding. Interestingly, however, the wound-inducible BrPR4 gene expression is repressed by salicylic acid or BTH, suggesting that there is cross-talk between salicylate-dependent and -independent signaling pathways.

• Journal of Plant Biotechnology
• /
• 제44권2호
• /
• pp.115-124
• /
• 2017

Cytoplasmic male sterility (CMS) is a maternally inherited trait leading to loss of the ability to produce fertile pollen and is extensively used in hybrid crop breeding. Ogura-CMS was originally generated by insertion of orf138 upstream of atp8 in the radish mitochondrial genome and transferred to Brassica crops for hybrid breeding. Gene expression changes by dysfunctional mitochondria in Ogura-CMS result in pollen developmental defects, but little is known about gene expression patterns in vegetative tissue. To examine the interaction between nuclear and organellar regulation of gene expression, microarray and subsequent gene expression experiments were conducted with leaves of $F_1$ hybrid Chinese cabbage derived from self-incompatible (SI) or Ogura-CMS parents (Brassica rapa ssp. pekinensis). Out of 24,000 genes deposited on a KBGP24K microarray, 66 genes were up-regulated and 26 genes were down-regulated by over 2.5 fold in the CMS leaves. Up-regulated genes included stress-response genes and mitochondrial protein genes, while genes for ascorbic acid biosynthesis and thylakoid proteins were down-regulated. Most of the major component genes for light reactions of photosynthesis were highly expressed in leaves of both SI and CMS plants, but most of the corresponding proteins were found to be greatly reduced in leaves of CMS plants, indicating posttranscriptional regulation. Reduction in thylakoid proteins and chlorophylls led to reduction in photosynthetic efficiency and chlorosis of Ogura-CMS at low temperatures. This research provides a foundation for studying chloroplast function regulated by mitochondrial signal and for using organelle genome introgression in molecular breeding.

• 한국식품영양과학회지
• /
• 제42권9호
• /
• pp.1412-1418
• /
• 2013

본 연구는 중국유래 14 품종 청경채의 영양적 특성을 평가하고자 수행되었다. 14종의 신규 청경채(Brassica rapa L. ssp. chinensis)를 대표적인 국산 배추(Brassica rapa L. ssp. pekinensis) 4 품종과 함께 2008년 충남 예산에서 재배하여 수확한 후 녹색 부위와 백색 부위로 나누어 부위 별 각종 영양 성분 분석을 수행하였다. 청경채의 수분 및 회분함량은 배추에 비교하여 유의적 차이가 없었으나 수분은 백색 부위에서, 회분은 녹색 부위에서 높게 나타났다. 전체적인 무기염류 함량은 배추에 비하여 청경채가 높은 것으로 측정되었는데 특히 녹색 부위의 함유량이 유의적으로 높은 것으로 드러났다. 특히 현대인의 건강에 매우 중요한 Ca과 Mg의 함유량은 청경채(Ca녹색: 2.57, Ca백색: 2.04; Mg녹색: 0.422, Mg백색: 0.301 mg/g 신선물 기준)가 배추(Ca녹색: 0.805, Ca백색: 0.477; Mg녹색: 0.244, Mg백색: 0.101 mg/g 신선물 기준)에 비하여 매우 높았다. 환원당의 함량은 청경채와 배추가 유사한 값을 나타내었고 색에 따른 유의적 차이도 없었다. 펙틴은 부위에 따른 차이는 있으나 청경채에서 그 함량이 높게 나타났고, 식물 조직의 경도에 영향이 큰 셀룰로오스의 함량은 청경채가 약 4배 이상 배추보다 높았다. 비타민 C와 E 함량은 청경채와 배추가 유사한 것으로 측정되었다. 위와 같이 청경채는 영양적으로 매우 우수하여 소비자들에게 권장할 만한 매일 섭취해야 할 주요 채소작물의 하나로 손색이 없음을 알 수 있었다. 또한 청경채는 국내 배추의 품질 향상을 위한 육종 소재로서도 활용가치가 높을 것으로 사료된다.

• Journal of Microbiology
• /
• 제39권1호
• /
• pp.56-61
• /
• 2001

Plasmodiophora brassicae is an obligate parasite, a causal organism of clubroot disease in crucifers that can survive in the soil as resting spores for many years. P. brassicae causes great losses in susceptible varieties of crucifers throughout the world. In this present study, an in planta molecular marker for the detection of P. bassicae was developed using an oligonucleotide primer set foam the small subunit gene (18S like) and internal transcribed spacer (ITS) region of rDNA. The specific primer sequences determined were TCAGCTTGAATGCTAATGTG (ITS5) and CTACCTCATTTGAGATCCTTTGA (PB-2). This primer set was used to specifically detect p. bassicae in planta. The amplicon using the specific primer set was about 1,000 bp. However, the test plant and other soil-borne fungi including Fusarium spp. and Rhizoctonia app., as well as bacteria such as Pseudomonas app. and Erwinia sup. did not show any reaction with the primer set.

• Journal of Plant Biology
• /
• 제15권2호
• /
• pp.7-19
• /
• 1972

The studies of density effect or the effect of population density on plant growth have been done on basis of dry matter production with Raphanus acanthiformis var. simoodaeguen, Brassica campestris var. Pekinensis f. namsounsokoombecheu, Oryza sativa f. kimmajae and O. sativa f. mangyeng grown in the various spacing. 1. In the early period of plant growth in dry weight was not different each other among varying densities, but as time advanced the plant grown vast space grew sufficiently compared with those of narrow one. 2. Iogarithmic relation between the growth of plant (W) and the density (P), log W-log P in the material plants, were approximated by two straight lines, one was horizontal line and another inclined: the former showed non-competition density and the latter competition density addition to these the point interlinking both lines were implied of the optimum density per unit land area at certain growth period. 3. The values of relatvie growth rate (RGR) and net assimilation rate (NAR) were decreased as increase in the density, while those of leaf area ratio (LAR) were rather increased in the same condition, with minor exception. From these results and relation between the productive structure and due to lack of the recieved light intensity owing to the mutal shading among the plants.

• Journal of Plant Biotechnology
• /
• 제5권4호
• /
• pp.209-214
• /
• 2003

Expression of 43 flowering-related genes was examined in two inbred lines of Chinese cabbage, Chiifu and Kenshin, under different photoperiod, vernalization and flower development stages. The floral genes cloned by RT-PCR with degenerated primers showed high homology with Arabidopsis counterparts. Genes in two inbred lines, TOC, CRY1, CO, RGAL and GAl, were highly expressed under all tested conditions. However, expression of three genes was regulated by particular experimental conditions. The expression of LHY gene was predominant in Chiifu under the short-day conditions, whereas the expression of RGAL gene was influenced by vernalization in both inbred lines. Besides, the expression of NAP gene was induced by vernalization only in Chiifu. Most of the flower identity-related genes were expressed during flower development. The transcript level for several genes was not detected in this experiment.