The present study was conducted to investigate the genetic characteristic and to establish the parentage verification system of the Korean native horse(KNH). A total number of 192 horses from six horse breeds including the KNH were genotyped using 17 microsatellite loci. This method consisted of multiplexing PCR procedure. The number of alleles per locus varied from 5 to 10 with a mean value of 7.35 in KNH. The expected heterozygosity and observed heterozygosity were ranged from 0.387 to 0.841(mean 0.702) and from 0.429 to 0.905(mean 0.703), respectively. The total exclusion probability of 17 microsatellite loci was 0.9999. Of the 17 markers, AHT4, AHT5, CA425, HMS2, HMS3, HTG10, LEX3 and VHL20 marker have relatively high PIC value(>0.7). This study found that there were specific alleles, P allele at AHT5, Q allele and R allele at ASB23, H allele at CA425, S allele at HMS3, J allele at HTG10 and J allele at LEX3 marker in KNH when compared with other horse populations. Also, the results showed two distinct clusters: the Korean native horse cluster(Korean native horse, Mongolian horse), and the European cluster(Jeju racing horse, Thoroughbred horse). These results present basic information for detecting the genetic markers of the KNH, and has high potential for parentage verification and individual identification of the KNH.
Plasmodiophora brassicae is an obligate parasite, a causal organism of clubroot disease in crucifers that can survive in the soil as resting spores for many years. P. brassicae causes great losses in susceptible varieties of crucifers throughout the world. In this present study, an in planta molecular marker for the detection of P. bassicae was developed using an oligonucleotide primer set foam the small subunit gene (18S like) and internal transcribed spacer (ITS) region of rDNA. The specific primer sequences determined were TCAGCTTGAATGCTAATGTG (ITS5) and CTACCTCATTTGAGATCCTTTGA (PB-2). This primer set was used to specifically detect p. bassicae in planta. The amplicon using the specific primer set was about 1,000 bp. However, the test plant and other soil-borne fungi including Fusarium spp. and Rhizoctonia app., as well as bacteria such as Pseudomonas app. and Erwinia sup. did not show any reaction with the primer set.
KIM Woo-Jin;KIM Kyung-Kil;LEE Jeong-Ho;PARK Doo-Won
Korean Journal of Fisheries and Aquatic Sciences
/
v.36
no.3
/
pp.317-320
/
2003
Morphologically similar fish species were subjected to the random amplified polymorphic DNA (RAPD) analysis using universal rice primer (URP). The fish species tested were sea basses (Lateolabrax japonicus and L. maculatus), eels (Anguilla japonica, A. bicolor bicolor, A. rostrata, and A. anguilla), and flounders (Limanda yokohamae and L. herzensteinin). Highly reproducible RAPD patterns were observed with several potential species-specific markers. The results indicate that RAPD technique using URP is useful for distinguishing fish psecies in a rapid manner.
Kim, Su Cheol;Kim, Hye Soo;Cho, Yong Un;Ryu, Jae-San;Cho, Soo Jeong
Journal of Mushroom
/
v.13
no.1
/
pp.79-83
/
2015
In this study, SCAR marker that differentiates Pleurotus eryngii strains with higher ${\beta}$-glucan from control strain was developed. Genomic DNAs of 9 control strains of Pleurotus eryngii and 9 Pleurotus eryngii strains with higher ${\beta}$-glucan were analyzed by bulked segregant analysis (BSA) using randomly amplified polymorphic DNA (RAPD). One-hundred twenty RAPD primers were screened on bulked DNA samples and a unique DNA fragment with the size of 91 bp was yielded by OP-R03 primer from the Pleurotus eryngii strains with higher ${\beta}$-glucan. A sequence characterized amplified region (SCAR) marker, designated as OP-R03-1-F and OP-R03-1-R, was designed on the basis of the determined sequence. The PCR analysis with the OP-R03-1 primer showed that this SCAR marker can clearly distinguish the Pleurotus eryngii strains with higher ${\beta}$-glucan from the control strains.
Kim, Su Cheol;Kim, Hye Soo;Park, So Yeon;Ryu, Jae-San;Cho, Soo Jeong
Journal of Mushroom
/
v.12
no.3
/
pp.226-231
/
2014
In this study, SCAR marker that differentiates Pleurotus eryngii strains adaptable to high-temperature from control strain was developed. Genomic DNAs of 7 control strains of Pleurotus eryngii and 7 Pleurotus eryngii strains adaptable to high-temperature were analyzed by bulked segregant analysis (BSA) using randomly amplified polymorphic DNA (RAPD). Onehundred twenty RAPD primers were screened on bulked DNA samples and a unique DNA fragment with the size of 385 bp was yielded by OP-A06 primer from the Pleurotus eryngii strains adaptable to high-temperature. A sequence characterized amplified region (SCAR) marker, designated as OP-A06-1-F and OP-A06-1-R, was designed on the basis of the determined sequence. The PCR analysis with the OP-A06-1 primer showed that this SCAR marker can clearly distinguish the Pleurotus eryngii strains adaptable to high-temperature from the control strains.
Kim, Wook Jin;Lee, Young Mi;Ji, Yunui;Kang, Young Min;Choi, Goya;Kim, Ho Kyoung;Moon, Byeong Cheol
The Korea Journal of Herbology
/
v.29
no.6
/
pp.35-43
/
2014
Objectives : Official Arisaematis Rhizoma is described only three species, Arisaema amurnse, Arisaema erubescens, and Arisaema heterophyllum, in national Pharmacopoeia. However, other Arisaema species, Arisaema ringens, Arisaema takesimense and Arisaema serratum, also have been distributed as an inauthentic Arisaematis Rhizoma in the herbal market. To develop a reliable molecular authentication method for Arisaematis Rhizoma in species level, we analyzed DNA barcode regions using six Arisaema species. Methods : Thirty-eight samples of six Arisaema plants species (A. amurense, A. amurense f. serratum, A. heterophyllum, A. takesimense, and A. serratum) were collected from different habitate and nucleotide sequences of DNA barcode regions (rDNA-ITS, matK, and rbcL gene) were analyzed after PCR amplification. The species-specific sequences and phylogenetic relations were estimated using entire sequences of three DNA barcodes based on the analysis of ClastalW and UPGMA, respectively. Results : The comparative analysis of DNA barcode sequences were revealed inter-species specific nucleotides to distinguish the medicinal plant of Arisaema Rhizoma in species levels excluding between A. amurense and its subspecies (A. amurense f. serratum) and A. takesimense and A. serratum, respectively. However, we obtained sequence differences enough to discriminate authentic and inauthentic Arisaematis Rhizoma. Therefore, we suggest that these SNP type molecular genetic markers were an reliable method avaliable to identify official herbal medicines. Conclusions : These marker nucleotides could be useful to identify the official herbal medicines by providing definitive information that can identify original medicinal plant and distinguish from inauthentic adulterants and substitutes.
Proceedings of the Korean Institute of Information and Commucation Sciences Conference
/
2017.05a
/
pp.288-290
/
2017
Recently, interest and demand of Augmented Reality(AR) contents are increasing as an application field of AR. Generally, when the AR contents are served in the outdoor environment, the position information using the GPS signal is used to control the display of the object on the AR screen, or a marker based on the image of the object is used. However, there is a problem that location information can not be used in an indoor environment. If the service is provided using only the marker, there is a problem that the recognition of the marker due to the moving obstacle in the vicinity is unstable. and there is a problem that information displayed on the AR screen is not displayed in a fixed state at a specific position, it moves according to the movement of the camera. In this paper, we have studied the object control method for displaying the object to be displayed on the AR screen by using iBeacon using indoor location recognition and specific markers.
The application of the cellulase gene (celA) as a selection marker of food-grade integration system was investigated in Lactobacillus (Lb.) casei, Lactococcus lactis, and Leuconostoc (Leu.) mesenteroides. The 6.0-kb vector pOC13 containing celA from Clostridium thermocellum with an integrase gene and a phage attachment site originating from bacteriophage A2 was used for site-specific recombination into chromosomal DNA of lactic acid bacteria (LAB). pOC13 was also equipped with a broad host range plus replication origin from the lactococcal plasmid pWV01, and a controllable promoter of nisA ($P_{nisA}$) for the production of foreign proteins. pOC13 was integrated successfully into Lb. casei EM116, and pOC13 integrants were easily detectable by the formation of halo zone on plates containing cellulose. Recombinant Lb. casei EM 116::pOC13 maintained these traits in the absence of selection pressure during 100 generations. pOC13 was integrated into the chromosome of L. lactis and Leu. mesenteroides, and celA acted as an efficient selection marker. These results show that celA can be used as a food-grade selection marker, and that the new integrative vector could be used for the production of foreign proteins in LAB.
Moon, Byeong Cheol;Lee, Young Mi;Ji, Yunui;Choi, Goya;Chun, Jin Mi;Kim, Ho Kyoung
The Korea Journal of Herbology
/
v.28
no.3
/
pp.75-84
/
2013
Objectives : The origin of Breeae Herba (So-gye) and Cirsii Herba (Dae-gye) is differently prescribed in Korean and Chinese modern pharmacopoeia. Since the similar morphological characteristics and chaotic plant names, moreover, the aerial part of Carduus crispus have been used as the Cirsii Herba. To develop a reliable method for correct identification of these herbal medicines and to evaluate the genetic relationship of these closely related plant species, we analyzed sequences of DNA barcode regions. Methods : Thirty-one samples of 6 medicinal plants (B. segeta, B. setosa, C. japonicum var. maackii, C. setidens, C. chanroenicum, and C. crispus) were collected from different habitate and nucleotide sequences of DNA barcode regions (rDNA-ITS, matK, and rbcL) were analyzed after amplification using appropriate primers reported in previous studies. The nucleotides of species-specific authentic marker and phylogenetic relations were estimated based on the entire sequences of DNA barcodes by the analysis of ClastalW and UPGMA, respectively. Results : In comparative analysis of DNA barcode sequences, we obtained specific nucleotides to discriminate the medicinal plant of Breeae/Cirsii Herba in species level and evaluated the phylogenetic relationship of these species. Futhermore, we identified distinct marker nucleotides enough to authenticate respective species. These sequence differences at corresponding positions were avaliable genetic markers to determine the botanical origins of Breeae Herbal as well as Cirsii Herba. Conclusions : These marker nucleotides would be useful to identify the official herbal medicines by providing of definitive information that can identify each plant species and distinguish from unauthentic adulterants and substitutes.
본 웹사이트에 게시된 이메일 주소가 전자우편 수집 프로그램이나
그 밖의 기술적 장치를 이용하여 무단으로 수집되는 것을 거부하며,
이를 위반시 정보통신망법에 의해 형사 처벌됨을 유념하시기 바랍니다.
[게시일 2004년 10월 1일]
이용약관
제 1 장 총칙
제 1 조 (목적)
이 이용약관은 KoreaScience 홈페이지(이하 “당 사이트”)에서 제공하는 인터넷 서비스(이하 '서비스')의 가입조건 및 이용에 관한 제반 사항과 기타 필요한 사항을 구체적으로 규정함을 목적으로 합니다.
제 2 조 (용어의 정의)
① "이용자"라 함은 당 사이트에 접속하여 이 약관에 따라 당 사이트가 제공하는 서비스를 받는 회원 및 비회원을
말합니다.
② "회원"이라 함은 서비스를 이용하기 위하여 당 사이트에 개인정보를 제공하여 아이디(ID)와 비밀번호를 부여
받은 자를 말합니다.
③ "회원 아이디(ID)"라 함은 회원의 식별 및 서비스 이용을 위하여 자신이 선정한 문자 및 숫자의 조합을
말합니다.
④ "비밀번호(패스워드)"라 함은 회원이 자신의 비밀보호를 위하여 선정한 문자 및 숫자의 조합을 말합니다.
제 3 조 (이용약관의 효력 및 변경)
① 이 약관은 당 사이트에 게시하거나 기타의 방법으로 회원에게 공지함으로써 효력이 발생합니다.
② 당 사이트는 이 약관을 개정할 경우에 적용일자 및 개정사유를 명시하여 현행 약관과 함께 당 사이트의
초기화면에 그 적용일자 7일 이전부터 적용일자 전일까지 공지합니다. 다만, 회원에게 불리하게 약관내용을
변경하는 경우에는 최소한 30일 이상의 사전 유예기간을 두고 공지합니다. 이 경우 당 사이트는 개정 전
내용과 개정 후 내용을 명확하게 비교하여 이용자가 알기 쉽도록 표시합니다.
제 4 조(약관 외 준칙)
① 이 약관은 당 사이트가 제공하는 서비스에 관한 이용안내와 함께 적용됩니다.
② 이 약관에 명시되지 아니한 사항은 관계법령의 규정이 적용됩니다.
제 2 장 이용계약의 체결
제 5 조 (이용계약의 성립 등)
① 이용계약은 이용고객이 당 사이트가 정한 약관에 「동의합니다」를 선택하고, 당 사이트가 정한
온라인신청양식을 작성하여 서비스 이용을 신청한 후, 당 사이트가 이를 승낙함으로써 성립합니다.
② 제1항의 승낙은 당 사이트가 제공하는 과학기술정보검색, 맞춤정보, 서지정보 등 다른 서비스의 이용승낙을
포함합니다.
제 6 조 (회원가입)
서비스를 이용하고자 하는 고객은 당 사이트에서 정한 회원가입양식에 개인정보를 기재하여 가입을 하여야 합니다.
제 7 조 (개인정보의 보호 및 사용)
당 사이트는 관계법령이 정하는 바에 따라 회원 등록정보를 포함한 회원의 개인정보를 보호하기 위해 노력합니다. 회원 개인정보의 보호 및 사용에 대해서는 관련법령 및 당 사이트의 개인정보 보호정책이 적용됩니다.
제 8 조 (이용 신청의 승낙과 제한)
① 당 사이트는 제6조의 규정에 의한 이용신청고객에 대하여 서비스 이용을 승낙합니다.
② 당 사이트는 아래사항에 해당하는 경우에 대해서 승낙하지 아니 합니다.
- 이용계약 신청서의 내용을 허위로 기재한 경우
- 기타 규정한 제반사항을 위반하며 신청하는 경우
제 9 조 (회원 ID 부여 및 변경 등)
① 당 사이트는 이용고객에 대하여 약관에 정하는 바에 따라 자신이 선정한 회원 ID를 부여합니다.
② 회원 ID는 원칙적으로 변경이 불가하며 부득이한 사유로 인하여 변경 하고자 하는 경우에는 해당 ID를
해지하고 재가입해야 합니다.
③ 기타 회원 개인정보 관리 및 변경 등에 관한 사항은 서비스별 안내에 정하는 바에 의합니다.
제 3 장 계약 당사자의 의무
제 10 조 (KISTI의 의무)
① 당 사이트는 이용고객이 희망한 서비스 제공 개시일에 특별한 사정이 없는 한 서비스를 이용할 수 있도록
하여야 합니다.
② 당 사이트는 개인정보 보호를 위해 보안시스템을 구축하며 개인정보 보호정책을 공시하고 준수합니다.
③ 당 사이트는 회원으로부터 제기되는 의견이나 불만이 정당하다고 객관적으로 인정될 경우에는 적절한 절차를
거쳐 즉시 처리하여야 합니다. 다만, 즉시 처리가 곤란한 경우는 회원에게 그 사유와 처리일정을 통보하여야
합니다.
제 11 조 (회원의 의무)
① 이용자는 회원가입 신청 또는 회원정보 변경 시 실명으로 모든 사항을 사실에 근거하여 작성하여야 하며,
허위 또는 타인의 정보를 등록할 경우 일체의 권리를 주장할 수 없습니다.
② 당 사이트가 관계법령 및 개인정보 보호정책에 의거하여 그 책임을 지는 경우를 제외하고 회원에게 부여된
ID의 비밀번호 관리소홀, 부정사용에 의하여 발생하는 모든 결과에 대한 책임은 회원에게 있습니다.
③ 회원은 당 사이트 및 제 3자의 지적 재산권을 침해해서는 안 됩니다.
제 4 장 서비스의 이용
제 12 조 (서비스 이용 시간)
① 서비스 이용은 당 사이트의 업무상 또는 기술상 특별한 지장이 없는 한 연중무휴, 1일 24시간 운영을
원칙으로 합니다. 단, 당 사이트는 시스템 정기점검, 증설 및 교체를 위해 당 사이트가 정한 날이나 시간에
서비스를 일시 중단할 수 있으며, 예정되어 있는 작업으로 인한 서비스 일시중단은 당 사이트 홈페이지를
통해 사전에 공지합니다.
② 당 사이트는 서비스를 특정범위로 분할하여 각 범위별로 이용가능시간을 별도로 지정할 수 있습니다. 다만
이 경우 그 내용을 공지합니다.
제 13 조 (홈페이지 저작권)
① NDSL에서 제공하는 모든 저작물의 저작권은 원저작자에게 있으며, KISTI는 복제/배포/전송권을 확보하고
있습니다.
② NDSL에서 제공하는 콘텐츠를 상업적 및 기타 영리목적으로 복제/배포/전송할 경우 사전에 KISTI의 허락을
받아야 합니다.
③ NDSL에서 제공하는 콘텐츠를 보도, 비평, 교육, 연구 등을 위하여 정당한 범위 안에서 공정한 관행에
합치되게 인용할 수 있습니다.
④ NDSL에서 제공하는 콘텐츠를 무단 복제, 전송, 배포 기타 저작권법에 위반되는 방법으로 이용할 경우
저작권법 제136조에 따라 5년 이하의 징역 또는 5천만 원 이하의 벌금에 처해질 수 있습니다.
제 14 조 (유료서비스)
① 당 사이트 및 협력기관이 정한 유료서비스(원문복사 등)는 별도로 정해진 바에 따르며, 변경사항은 시행 전에
당 사이트 홈페이지를 통하여 회원에게 공지합니다.
② 유료서비스를 이용하려는 회원은 정해진 요금체계에 따라 요금을 납부해야 합니다.
제 5 장 계약 해지 및 이용 제한
제 15 조 (계약 해지)
회원이 이용계약을 해지하고자 하는 때에는 [가입해지] 메뉴를 이용해 직접 해지해야 합니다.
제 16 조 (서비스 이용제한)
① 당 사이트는 회원이 서비스 이용내용에 있어서 본 약관 제 11조 내용을 위반하거나, 다음 각 호에 해당하는
경우 서비스 이용을 제한할 수 있습니다.
- 2년 이상 서비스를 이용한 적이 없는 경우
- 기타 정상적인 서비스 운영에 방해가 될 경우
② 상기 이용제한 규정에 따라 서비스를 이용하는 회원에게 서비스 이용에 대하여 별도 공지 없이 서비스 이용의
일시정지, 이용계약 해지 할 수 있습니다.
제 17 조 (전자우편주소 수집 금지)
회원은 전자우편주소 추출기 등을 이용하여 전자우편주소를 수집 또는 제3자에게 제공할 수 없습니다.
제 6 장 손해배상 및 기타사항
제 18 조 (손해배상)
당 사이트는 무료로 제공되는 서비스와 관련하여 회원에게 어떠한 손해가 발생하더라도 당 사이트가 고의 또는 과실로 인한 손해발생을 제외하고는 이에 대하여 책임을 부담하지 아니합니다.
제 19 조 (관할 법원)
서비스 이용으로 발생한 분쟁에 대해 소송이 제기되는 경우 민사 소송법상의 관할 법원에 제기합니다.
[부 칙]
1. (시행일) 이 약관은 2016년 9월 5일부터 적용되며, 종전 약관은 본 약관으로 대체되며, 개정된 약관의 적용일 이전 가입자도 개정된 약관의 적용을 받습니다.