• Journal of Life Science
• /
• v.17 no.5 s.85
• /
• pp.699-705
• /
• 2007

The present study was conducted to investigate the genetic characteristic and to establish the parentage verification system of the Korean native horse(KNH). A total number of 192 horses from six horse breeds including the KNH were genotyped using 17 microsatellite loci. This method consisted of multiplexing PCR procedure. The number of alleles per locus varied from 5 to 10 with a mean value of 7.35 in KNH. The expected heterozygosity and observed heterozygosity were ranged from 0.387 to 0.841(mean 0.702) and from 0.429 to 0.905(mean 0.703), respectively. The total exclusion probability of 17 microsatellite loci was 0.9999. Of the 17 markers, AHT4, AHT5, CA425, HMS2, HMS3, HTG10, LEX3 and VHL20 marker have relatively high PIC value(>0.7). This study found that there were specific alleles, P allele at AHT5, Q allele and R allele at ASB23, H allele at CA425, S allele at HMS3, J allele at HTG10 and J allele at LEX3 marker in KNH when compared with other horse populations. Also, the results showed two distinct clusters: the Korean native horse cluster(Korean native horse, Mongolian horse), and the European cluster(Jeju racing horse, Thoroughbred horse). These results present basic information for detecting the genetic markers of the KNH, and has high potential for parentage verification and individual identification of the KNH.

• Journal of Microbiology
• /
• v.39 no.1
• /
• pp.56-61
• /
• 2001

Plasmodiophora brassicae is an obligate parasite, a causal organism of clubroot disease in crucifers that can survive in the soil as resting spores for many years. P. brassicae causes great losses in susceptible varieties of crucifers throughout the world. In this present study, an in planta molecular marker for the detection of P. bassicae was developed using an oligonucleotide primer set foam the small subunit gene (18S like) and internal transcribed spacer (ITS) region of rDNA. The specific primer sequences determined were TCAGCTTGAATGCTAATGTG (ITS5) and CTACCTCATTTGAGATCCTTTGA (PB-2). This primer set was used to specifically detect p. bassicae in planta. The amplicon using the specific primer set was about 1,000 bp. However, the test plant and other soil-borne fungi including Fusarium spp. and Rhizoctonia app., as well as bacteria such as Pseudomonas app. and Erwinia sup. did not show any reaction with the primer set.

• Korean Journal of Fisheries and Aquatic Sciences
• /
• v.36 no.3
• /
• pp.317-320
• /
• 2003

Morphologically similar fish species were subjected to the random amplified polymorphic DNA (RAPD) analysis using universal rice primer (URP). The fish species tested were sea basses (Lateolabrax japonicus and L. maculatus), eels (Anguilla japonica, A. bicolor bicolor, A. rostrata, and A. anguilla), and flounders (Limanda yokohamae and L. herzensteinin). Highly reproducible RAPD patterns were observed with several potential species-specific markers. The results indicate that RAPD technique using URP is useful for distinguishing fish psecies in a rapid manner.

• Proceedings of the Plant Resources Society of Korea Conference
• /
• 2002.04a
• /
• pp.33-33
• /
• 2002

• Journal of Mushroom
• /
• v.13 no.1
• /
• pp.79-83
• /
• 2015

In this study, SCAR marker that differentiates Pleurotus eryngii strains with higher ${\beta}$-glucan from control strain was developed. Genomic DNAs of 9 control strains of Pleurotus eryngii and 9 Pleurotus eryngii strains with higher ${\beta}$-glucan were analyzed by bulked segregant analysis (BSA) using randomly amplified polymorphic DNA (RAPD). One-hundred twenty RAPD primers were screened on bulked DNA samples and a unique DNA fragment with the size of 91 bp was yielded by OP-R03 primer from the Pleurotus eryngii strains with higher ${\beta}$-glucan. A sequence characterized amplified region (SCAR) marker, designated as OP-R03-1-F and OP-R03-1-R, was designed on the basis of the determined sequence. The PCR analysis with the OP-R03-1 primer showed that this SCAR marker can clearly distinguish the Pleurotus eryngii strains with higher ${\beta}$-glucan from the control strains.

• Journal of Mushroom
• /
• v.12 no.3
• /
• pp.226-231
• /
• 2014

In this study, SCAR marker that differentiates Pleurotus eryngii strains adaptable to high-temperature from control strain was developed. Genomic DNAs of 7 control strains of Pleurotus eryngii and 7 Pleurotus eryngii strains adaptable to high-temperature were analyzed by bulked segregant analysis (BSA) using randomly amplified polymorphic DNA (RAPD). Onehundred twenty RAPD primers were screened on bulked DNA samples and a unique DNA fragment with the size of 385 bp was yielded by OP-A06 primer from the Pleurotus eryngii strains adaptable to high-temperature. A sequence characterized amplified region (SCAR) marker, designated as OP-A06-1-F and OP-A06-1-R, was designed on the basis of the determined sequence. The PCR analysis with the OP-A06-1 primer showed that this SCAR marker can clearly distinguish the Pleurotus eryngii strains adaptable to high-temperature from the control strains.

• The Korea Journal of Herbology
• /
• v.29 no.6
• /
• pp.35-43
• /
• 2014

Objectives : Official Arisaematis Rhizoma is described only three species, Arisaema amurnse, Arisaema erubescens, and Arisaema heterophyllum, in national Pharmacopoeia. However, other Arisaema species, Arisaema ringens, Arisaema takesimense and Arisaema serratum, also have been distributed as an inauthentic Arisaematis Rhizoma in the herbal market. To develop a reliable molecular authentication method for Arisaematis Rhizoma in species level, we analyzed DNA barcode regions using six Arisaema species. Methods : Thirty-eight samples of six Arisaema plants species (A. amurense, A. amurense f. serratum, A. heterophyllum, A. takesimense, and A. serratum) were collected from different habitate and nucleotide sequences of DNA barcode regions (rDNA-ITS, matK, and rbcL gene) were analyzed after PCR amplification. The species-specific sequences and phylogenetic relations were estimated using entire sequences of three DNA barcodes based on the analysis of ClastalW and UPGMA, respectively. Results : The comparative analysis of DNA barcode sequences were revealed inter-species specific nucleotides to distinguish the medicinal plant of Arisaema Rhizoma in species levels excluding between A. amurense and its subspecies (A. amurense f. serratum) and A. takesimense and A. serratum, respectively. However, we obtained sequence differences enough to discriminate authentic and inauthentic Arisaematis Rhizoma. Therefore, we suggest that these SNP type molecular genetic markers were an reliable method avaliable to identify official herbal medicines. Conclusions : These marker nucleotides could be useful to identify the official herbal medicines by providing definitive information that can identify original medicinal plant and distinguish from inauthentic adulterants and substitutes.

• Proceedings of the Korean Institute of Information and Commucation Sciences Conference
• /
• 2017.05a
• /
• pp.288-290
• /
• 2017

Recently, interest and demand of Augmented Reality(AR) contents are increasing as an application field of AR. Generally, when the AR contents are served in the outdoor environment, the position information using the GPS signal is used to control the display of the object on the AR screen, or a marker based on the image of the object is used. However, there is a problem that location information can not be used in an indoor environment. If the service is provided using only the marker, there is a problem that the recognition of the marker due to the moving obstacle in the vicinity is unstable. and there is a problem that information displayed on the AR screen is not displayed in a fixed state at a specific position, it moves according to the movement of the camera. In this paper, we have studied the object control method for displaying the object to be displayed on the AR screen by using iBeacon using indoor location recognition and specific markers.

• Food Science and Biotechnology
• /
• v.17 no.6
• /
• pp.1221-1227
• /
• 2008

The application of the cellulase gene (celA) as a selection marker of food-grade integration system was investigated in Lactobacillus (Lb.) casei, Lactococcus lactis, and Leuconostoc (Leu.) mesenteroides. The 6.0-kb vector pOC13 containing celA from Clostridium thermocellum with an integrase gene and a phage attachment site originating from bacteriophage A2 was used for site-specific recombination into chromosomal DNA of lactic acid bacteria (LAB). pOC13 was also equipped with a broad host range plus replication origin from the lactococcal plasmid pWV01, and a controllable promoter of nisA ($P_{nisA}$) for the production of foreign proteins. pOC13 was integrated successfully into Lb. casei EM116, and pOC13 integrants were easily detectable by the formation of halo zone on plates containing cellulose. Recombinant Lb. casei EM 116::pOC13 maintained these traits in the absence of selection pressure during 100 generations. pOC13 was integrated into the chromosome of L. lactis and Leu. mesenteroides, and celA acted as an efficient selection marker. These results show that celA can be used as a food-grade selection marker, and that the new integrative vector could be used for the production of foreign proteins in LAB.

• The Korea Journal of Herbology
• /
• v.28 no.3
• /
• pp.75-84
• /
• 2013

Objectives : The origin of Breeae Herba (So-gye) and Cirsii Herba (Dae-gye) is differently prescribed in Korean and Chinese modern pharmacopoeia. Since the similar morphological characteristics and chaotic plant names, moreover, the aerial part of Carduus crispus have been used as the Cirsii Herba. To develop a reliable method for correct identification of these herbal medicines and to evaluate the genetic relationship of these closely related plant species, we analyzed sequences of DNA barcode regions. Methods : Thirty-one samples of 6 medicinal plants (B. segeta, B. setosa, C. japonicum var. maackii, C. setidens, C. chanroenicum, and C. crispus) were collected from different habitate and nucleotide sequences of DNA barcode regions (rDNA-ITS, matK, and rbcL) were analyzed after amplification using appropriate primers reported in previous studies. The nucleotides of species-specific authentic marker and phylogenetic relations were estimated based on the entire sequences of DNA barcodes by the analysis of ClastalW and UPGMA, respectively. Results : In comparative analysis of DNA barcode sequences, we obtained specific nucleotides to discriminate the medicinal plant of Breeae/Cirsii Herba in species level and evaluated the phylogenetic relationship of these species. Futhermore, we identified distinct marker nucleotides enough to authenticate respective species. These sequence differences at corresponding positions were avaliable genetic markers to determine the botanical origins of Breeae Herbal as well as Cirsii Herba. Conclusions : These marker nucleotides would be useful to identify the official herbal medicines by providing of definitive information that can identify each plant species and distinguish from unauthentic adulterants and substitutes.