• 원예과학기술지
• /
• 제28권4호
• /
• pp.672-677
• /
• 2010

유전자변형 장미 개발에 이용된 형질전환 벡터 pSPB130을 검출할 있는 duplex PCR이 개발되었다. 유전자변형 장미를 검출하기 위해 anthocyanin synthase($ANS$)가 장미 내 재유전자로 PCR 검사법에 이용하였다. 107bp의 PCR 산물을 얻을 수 있는 RHANS-KF/KR primer가 ANS 유전자를 증폭시키는데 이용되었고, 이것을 이용하여 9개의 다른 식물에 대해서 PCR한 결과 장미에서만 특이적인 증폭산물이 확인되었다. GMRH-KF/KR primer가 형질전환 벡터 pSPB130에 삽입된 35S promoter와 flavonoid 3',5'-hydroxylase($F3^{\prime}5^{\prime}H$) 사이의 염기서열을 확인할 수 있도록 제작되었다. 본 연구에서 개발된 duplex PCR의 검정한계치는 약 0.5%이며, 이러한 duplex PCR이 우리나라 미승인 유전자변형 장미를 모니터링 하는데 유용하게 사용될 수 있을 것이다.

• Journal of Plant Biology
• /
• 제35권2호
• /
• pp.155-163
• /
• 1992

식물세포에 tumor를 유발하는 Agrobacterium tumefaciens pTiA6 plasmid에서 virE 유전자의 발현조절기작을 분자적수준에서 규명하기 위하여 virE promoter의 5＇-말단을 제거하여 얻은 truncated virE 재조합플라스미드를 이용하여 virE promoter의 조절부위에 대하여 연구하였다. virE promoter의 기능이 존재하는 truncated virE 재조합플라스미드인 pJS201은 전기영동에 의하여 virE promoter의 5＇-말단으로부터 약 130개의 염기가 제거된 것으로 측정되었다. 한편 virE promoter의 기능을 상실한 pJS301에서 dideoxy chain termination방법으로 truncated virE promoter 염기서열을 결정한 결과 263개의 염기가 제거된 것으로 확인되었다. 따라서 virE promoter의 조절부위는 virE promoter의 5＇-말단으로부터 약 130번째의 염기에서 263번째의 염기사이에 존재하는 것으로 사료되며, 이 사이에 23개의 염기로 이루어진 역반복서열(AACTTTGCGCTATAGGCAAAGTT)이 존재하고 있는데, 이 부위가 virE operon의 발현에 있어서 RNA polymerase의 최초 인식부위(recognition site)일 것으로 사료된다.

• 한국초지조사료학회지
• /
• 제24권4호
• /
• pp.317-323
• /
• 2004

본 연구는 답리작에서 사일리지용 보리품종을 파종방법과 파종량에 따른 생육특성, 생초 및 건물수량에 미치는 영향을 구명하고자 수원소재 축산연구소에서 2001년 10월부터 2003년 5월까지 3년간 수행하였다. 본 연구는 분할구 시험법으로 3반복 설계 배치하였으며, 결과를 요약하면 다음과 같다. 파종방법과 파종량에 따른 사료용 보리의 내한성, 내병성 그리고 내도복성은 차이가 없었다. 그리고 수확시 건물률은 산파 130 kg/ha와 조파 130 kg/ha에서 각각 $32.0\%$와 $32.7\%$로 낮았다. 그리고 생초수량에 있어서는 조파 130kg/ha구에서 32,073 kg/ha으로 가장 많았고, 산파 130 kg/ha구에서 20,944 kg/ha으로 가장 적었다(P<0.05). 또한 건물수량에 있어서는 조파 160과 130 kg/ha구에서 각각 9,170와 9,138kg/ha으로 가장 많았고 산파 130 kg/ha구에서 5,710 kg/ha으로 가장 적었다(P<0.05). 따라서 본 시험의 결과를 종합하면 우리나라 답리작 논에서 사료용 보리의 파종방법에 있어 조파로 할 경우 ha당 130에서 160 kg/ha와 산파로 할 경우 190에서 220 kg/ha로 파종하는 것이 바람직하다고 생각된다.

• 한국응용곤충학회지
• /
• 제35권4호
• /
• pp.315-320
• /
• 1996

Drosophila의 actin 5C 유전자 promoter에 쥐의 DNA polymerase $\beta$cDNA를 도입시킨 형질전환 초파리가 고감수성 환경성 변이원 검출계로 사용할 수 있는지를 조사하였다. 체세포 염색체 재조환과 체세포 염색체 돌연변이의 검출을 위해서는 geterozygous(mwh/+) 계통을 사용하였다. 염색체상의 결실이나 비분리 등에 의한 small mwh spot의 자연 발생적 빈도는 non-transgenic w 계통과 transgenic p[pol $\beta$]-130 계통에서 각각 0.351 및 0.606 정도였다. 체세포 염색체 재조환에 의한 large mwh spot의 자연 발생적 빈도의 경우는 transgenic p[pol $\beta$]-130 계통(0.063)이 non-transgenic w 계통(0.021)에 비해 약 3배 정도 높게 나타났다. IQ, Glu-P-1 및 {TEX}$AFB_{1}${/TEX} 등의 돌연변이원의 처리에 의한 경우, 두 종류의 mutant clone의 발생 빈도는 쥐의 DNA polymerase $\beta$가 도입된 transgenic p[pol $\beta$]-130 계통이 non-transgenic w 계통에 비하여 모두 약 2-3배 정도 높게 나타났다. 본 연구의 결과는 쥐의 DNA polymerase $\beta$가 최소한 체세포 염색체 돌연변이 유발이나 체세포 염색체 재조환의 생성 과정에 관여함을 의미하며, 형질전환 초파리 계통이 환경성 변이원 검출계로서 충분한 응용가능성이 있음을 보여 주었다.

• 한국진공학회:학술대회논문집
• /
• 한국진공학회 2005년도 제29회 학술발표회 초록집
• /
• pp.130-130
• /
• 2005

• 한국전문물리치료학회지
• /
• 제17권1호
• /
• pp.36-42
• /
• 2010

The aim of this study was to investigate effects of reaching distance on movement time and trunk kinematics in hemiplegic patients. Eight hemiplegic patients participated in this study. The independent variables were side (sound side vs. affected side) and target distance (70%, 90%, 110%, and 130% of upper limb). The dependent variables were movement time measured by pressure switch and trunk kinematics measured by motion analysis device. Two-way analysis of variance with repeated measures was used with Bonferroni post-hoc test. (1) There were significant main effects in side and reaching distance for movement time (p=.01, p=.02). Post-hoc test revealed that there was a significant difference between 110% and 130% of reaching distance (p=.01). (2) There was a significant main effect in side and reaching distance for trunk flexion (p=.01, p=.00). Post-hoc test revealed that there were significant differences in all pair-wise reaching distance comparison. (3) There was a significant side by target distance interaction for trunk rotation (p=.04). There was a significant main effect in target distance (p=.00). Post-hoc test revealed that there were significant differences between 70% and 110%, 70% and 130%, 90% and 110%, 90% and 130% of target distance. It was known that trunk flexion is used more than trunk rotation during reaching task in hemiplegic patients from the findings of this study. It is also recommended that reaching training is performed with limiting trunk movement within 90% of target distance whereas reaching training is performed incorporating with trunk movement beyond 90% of target distance in patients with hemiplegia.

• 한국미생물·생명공학회지
• /
• 제17권4호
• /
• pp.358-364
• /
• 1989

토양으로부터 분리한 Streptomyces sp. YSA-130으로부터 활성이 좋은 결정화된 alkaline protease를 분리하였다. Alkaline protease 생산의 최적 배양조건은 2.0% soluble starch, 1.0% soytone, 0.3% $K_2$HPO$_4$, 0.02% MgSO$_4$.7$H_2O$, 0.8% $Na_2$CO$_3$ 3$0^{\circ}C$, pH 10.5에서 72 시간 배양하였을 때 였다. Alkaline protease이 정제는 (NH$_4$)$_2$SO$_4$. 분별침전, 투석, DEAE cellulose column chromatography, Sephadex G-75 gel filtration, crystallization으로 하였으며, 그 결과 비활성도 14,290unit/mg, 정제도 23.8 배였고, 수율은 20.0% 이었다. Alkaline protease의 반응 최적온도와 pH는 6$0^{\circ}C$ 와 11.5이었으며, 효소의 pH 안정성은 5.5-12.0에서 안정하였고, 온도 안정성은 5$0^{\circ}C$까지 안정하였으며, $Ca^{++}$ ion 첨가시 6$0^{\circ}C$까지 안정성이 증가하였다. Alkaline protease의 분자량은 30,000이었으며 금속이온, EDTA, 환원제는 활성에 영향이 없었고 DFP에 의해 저해되었다. 계면활성제에 저항성이 크고 $H_2O$$_2$에 대한 잔존활성은 60% 을 유지하였다.

• Reproductive and Developmental Biology
• /
• 제30권4호
• /
• pp.247-253
• /
• 2006

Our previous research has identified granulin (grn) and p130 genes as sex steroid-inducible genes in the rat hypothalamus, which might be involved in sexual differentiation of the brain. Phthalate esters that are used as plasticizers and also found at low levels in foods such as dairy products are often mentioned as suspected endocrine disrupters. The purpose of the present study is to elucidate whether perinatal exposure to di-n-butyl phthalate (DBP), diisononyl phthalate (DINP) and di-2-ethylhexyl adipate (DEHA) affects hypothalamic sex steroid-inducible genes. The present study assessed the effects of perinatal exposure to DBP, DINP and DEHA on sex steroid hormones levels and hypothalamic gm and p130 mRNA expressions at postnatal day (PND) 3 and 7. Pregnant rats were fed a soy-free diet containing 20, 200, 2,000 and 10,000 ppm of DBP, 40, 400, 4,000 and 20,000 ppm of DINP, or 480, 2,400 and 12,000 ppm of DEHA from gestational day (GD) 15 to GD 3 or 7. At PND 3 and 7, perinatal exposure to these chemicals did not substantially affect serum concentrations of testosterone and estradiol. At PND 3, the expression of grn mRNA levels in males was decreased by DEHA, and that of p130 was decreased by DBP, DINP and DEHA, though the effects were not dose-dependent. At PND 7, the expression of gm gene in female pups was increased by higher doses of DBP and all the doses, except for 4,000 ppm, of DINP, while that in male pups decreased by 480 and 12,000 ppm of DEHA. Hypothalamic expression of p130 mRNA in males was increased by lower doses of DBP and all the doses of DINP, whereas that of females was decreased by 480 and 2,400 ppm of DEHA. These results suggest that these chemicals may affect the expression of gm and p130 genes by directly acting on the hypothalamus, thus leading to inappropriate expression of these genes.

• 한국발생생물학회지:발생과생식
• /
• 제21권2호
• /
• pp.131-138
• /
• 2017

This study was conducted to investigate stimulatory effect of epidermal growth factor (EGF) on nuclear maturation and the expression level of EGF-receptor (EGFR), GM-130 (a marker of Golgi apparatus), transport protein Sec61 subunit beta ($Sec61{\beta}$), and coatomer protein complex subunit gamma 2 (COPG2) in porcine oocytes. The cumulus-oocyte complexes were collected from follicle with 3-6 mm in diameter. They were incubated in medium with/without EGF for 22 h (IVM I) and subsequently incubated hormone-free medium with/without EGF for 22 h (IVM II). Nuclear maturation state was checked by aceto-orcein stain. Protein expression of EGFR, GM-130, $Sec61{\beta}$, and COPG2 were measured by immunofluorescence. In results, nuclear maturation of oocytes in EGF non-treated oocytes were significantly lower than EGF-treated groups at IVM I or IVM II stage (P<0.05), whereas maturational rate in EGF treatment groups at both of IVM stage was higher in among the all treatment groups (P<0.05). EGFR, GM-130, $Sec61{\beta}$ and COPG2 were expressed in the cytoplasm of oocytes. Especially, GM-130 and EGFR were strongly expressed, but $Sec61{\beta}$ and COPG2 were weakly expressed in cortical area of cytoplasm. The protein level of GM-130, $Sec61{\beta}$, and COPG2 were significantly higher in the EGF-treated groups (P<0.05). However EGFR was no difference between non EGF-treated groups and control. In conclusion, EGF plays an important role in the systems for oocyte maturation with endoplasmic reticulum and Golgi apparatus. In addition, the protein levels of $Sec61{\beta}$ and COPG2 could be changed by EGF in the porcine oocytes during maturation.

• 대한치과보철학회지
• /
• 제35권3호
• /
• pp.445-457
• /
• 1997

Poor marginal fidelity resulting in a large marginal gap increases plaque accumulation, gingival inflammation and dental caries. The purpose of this study was to evaluate the marginal fit of three different cervical finishing methods of prepared teeth. A stereomicroscope was used to measure the space between the margin of restoration and the finishing line of prepared tooth. The results were statistically analyzed using the ANOVA and Multiple Range Test(Tukey's HSD). The results were as follows : 1. There were no significant differences concerning the types of tooth and positon (P>0.05), whereas the differences were statistically significant in case of cervical finishing methods (P<0.05). 2. There were statistically significant differences between before and after cementation (P<0.05). 3. In comparison according to variable margins after cementation, the gap discrepancies were increased in $130^{\circ}$ shoulder margin, chamfer margin and $90^{\circ}$ shoulder margin in ascending order, and there were significant differences between $90^{\circ}$ shoulder margin and chamfer, $130^{\circ}$ shoulder margin 4. In comparison according to variable margins, the gap discrepancies were increased in chamfer margin, $130^{\circ}$ shoulder margin and $90^{\circ}$ shoulder margin in ascending order, and there were significant differences between $90^{\circ}$ shoulder margin and chamfer, $130^{\circ}$ shoulder margin. 5. This study demonstrated a better marginal fit with all-ceramic crowns fabricated on chamfer and $130^{\circ}$ shoulder margin compared with $90^{\circ}$ shoulder margin.