• Journal of Microbiology
• /
• 제39권1호
• /
• pp.56-61
• /
• 2001

Plasmodiophora brassicae is an obligate parasite, a causal organism of clubroot disease in crucifers that can survive in the soil as resting spores for many years. P. brassicae causes great losses in susceptible varieties of crucifers throughout the world. In this present study, an in planta molecular marker for the detection of P. bassicae was developed using an oligonucleotide primer set foam the small subunit gene (18S like) and internal transcribed spacer (ITS) region of rDNA. The specific primer sequences determined were TCAGCTTGAATGCTAATGTG (ITS5) and CTACCTCATTTGAGATCCTTTGA (PB-2). This primer set was used to specifically detect p. bassicae in planta. The amplicon using the specific primer set was about 1,000 bp. However, the test plant and other soil-borne fungi including Fusarium spp. and Rhizoctonia app., as well as bacteria such as Pseudomonas app. and Erwinia sup. did not show any reaction with the primer set.

• Mycobiology
• /
• 제42권1호
• /
• pp.12-16
• /
• 2014

We isolated and examined a new Alternaria sp., which causes leaf spots on Peucedanum japonicum in Korea, by using molecular and morphological methods. Phylogenetic analysis based on a combined internal transcribed spacer region analysis and two protein-coding genes (gpd and Alt a1) demonstrated that the causal fungus was most closely related to A. cinerariae and A. sonchi, and relevant to A. brassicae. However, conidial morphology indicated that it is a novel species within the genus Alternaria, and therefore we have assigned the fungus a new name in this study.

• 한국균학회지
• /
• 제43권3호
• /
• pp.191-195
• /
• 2015

A new species of Neosartorya was recovered during investigation of the fungal community in soil samples collected from different locations in Korea; Neosartorya aureola KNU14-7 was isolated for the first time from field soil in Korea and identified based on the internal transcribed spacer region of rDNA and morphological characteristics. The species has not been officially reported from Korea and we report it here with description and figures.

• Mycobiology
• /
• 제43권2호
• /
• pp.166-169
• /
• 2015

We report the isolation of a Gongronella butleri species and describe it based on the analysis of the internal transcribed spacer region of rDNA and morphological characteristics. G. butleri has been reported as a high chitosan producer in the literature. This is the first record of G. butleri isolated from crop field soil in Korea.

• Mycobiology
• /
• 제45권2호
• /
• pp.64-72
• /
• 2017

In an ongoing survey of Korean indigenous fungi, three fungal strains belonging to the Sordariomycetes were isolated from soil samples. These strains were designated KNU16-001, KNU16-002, and KNU16-009, and identified as Ambrosiella grosmanniae, Acremonium sclerotigenum, and Trichocladium asperum, respectively, based on morphological characterization and phylogenetic analysis using internal transcribed spacer region sequences of ribosomal DNA. This is the first report of these species in Korea.

• Fisheries and Aquatic Sciences
• /
• 제11권1호
• /
• pp.32-35
• /
• 2008

The Suminoe oyster, Crassostrea ariakensis, occurs in estuaries where rivers meet seawater. In Korea, it is one of the most popular fisheries resources in the Nam River and Sumjin River. However, the genetic identification of this species has been questioned, because specimens are often mis-identified as other species. To identify the species, we conducted polymerase chain reaction (PCR) amplification of the internal transcribed spacer-1 (ITS-1) region, followed by digestion with the restriction enzyme HaeIII. Restriction profiles for oysters collected from Korea, Japan, and China (north and south) were determined by comparing the PCR-restriction fragment length polymorphism (RFLP) patterns of the ITS-1 regions. Our study verified that the oysters collected from Korea were C. ariakensis based on the PCR-RFLP patterns. These results emphasize the value of molecular markers for identifying morphologically uncertain species.

• Mycobiology
• /
• 제43권1호
• /
• pp.71-74
• /
• 2015

During a survey of fungal species in South Korea, a species of Volutella ciliata was isolated and described based on the analysis of the internal transcribed spacer region of its rDNA and its morphological characteristics. This is the first record of Volutella ciliata isolated from crop field soil in Korea.

• Mycobiology
• /
• 제38권4호
• /
• pp.316-320
• /
• 2010

Leaf spot and blight disease was observed on two-year-old seedlings of Dendropanax morbifera (Korean name: Hwangchil tree) during July of 2008 in Jindo Island, Korea. Symptoms included yellow-brown to dark brown irregularly enlarged spots frequently located along the veins of leaves. The lesions were often surrounded by chlorotic haloes. Severe leaf blight and subsequent defoliation occurred when conditions favored disease outbreak. The causal organism of the disease was identified as Alternaria panax based on morphological characteristics and sequence analysis of the internal transcribed spacer region of rDNA. A. panax isolates induced leaf spots and blight symptoms not only on D. morbifera but also on the other members of Araliaceae tested. This is the first report of foliar blight caused by A. panax on D. morbifera.

• Mycobiology
• /
• 제44권3호
• /
• pp.131-136
• /
• 2016

Gymnopus is a cosmopolitan genus of agaric fungi and consists of ~300 species. In Korea, Gymnopus represents common saprobic mushrooms, and 12 species have been reported in Korea. Several Gymnopus specimens were collected in Korea between 2008 and 2015. To identify them exactly, phylogenetic analysis was performed by means of the internal transcribed spacer region of ribosomal-DNA sequences from the collected Gymnopus specimens. Among them, G. iocephalus, G. polygrammus, and G. subnudus have not been reported in Korea. A phylogenetic tree and images are provided.

• 한국균학회지
• /
• 제46권3호
• /
• pp.227-233
• /
• 2018

A fungus was isolated from field soil collected from Daegu, Korea. The colony of the isolated fungus showed short, branched, and light to dark yellow pigments with hyaline, yellowish red to orange brown aerial mycelia. In addition, the fungus produced solitary to aggregated perithecia, ovoid to pyriform, short neck, and asci as well as biseriately arranged ascospores. Phylogenetic analysis using the internal transcribed spacer region and translation elongation factor $1-{\alpha}$ sequences and morphological characteristics identified the isolated fungus as Penicillifer diparietisporus, which belongs to the family Nectriaceae. To our knowledge, this is the first report of Penicillifer diparietisporus in Korea.