• Journal of fish pathology
• /
• v.23 no.2
• /
• pp.145-153
• /
• 2010

Prevalence of a protozoan parasite Perkinsus olseni in Manila clam Ruditapes philippinarum was surveyed from July to December 2009 on the west and south coast of Korea. P. olseni infection was diagnosed using two primer sets, P.olseni NTS Forward/P.olseni NTS Reverse set and PolsITS-140F/PolsITS-600R set in polymerase chain reaction(PCR). The results using PolsITS-140F and PolsITS-600R primer set was retained up to 60% at all stations from July to December, except for Padori. Especially, Goheung showed 100% prevalence from October to December. The results about comparison of the 4 station's DNA sequences which were analyzed from PCR products(457bp) using PolsITS-140F and PolsITS-600R primer set, there were only 2base differences at Sunjedo.

• The Korean Journal of Mycology
• /
• v.27 no.5 s.92
• /
• pp.337-340
• /
• 1999

The context and upper surface of Phellinus basidiocarp become blackened, rimose and woody. The basidiocarp is sessile, dimidiate and elongate. The basidiospores are pigmented and ovoid to globose. Hymenial setae are $17{\sim}35{\times}6{\sim}8{\mu}m$. Nineteen isolates of Phellinus species, including Phellinus linteus, were used for sequencing of the internal transcribed spacer (ITS) region of the nuclear rDNA. Based on these sequence data, specific primers were designed for identification of Phellinus linteus isolates in Korea. The specific primers were within the ITS1 and ITS2 regions and were nested within the universal primers flanking the spacer regions. A total of four primers (the universal primers ITS-1F and ITS-4, and the specific primers PL-F and PL-R) were used for detection of Phellinus linteus collected in Korea. The length of the four amplification products of Phellinus linteus DNA were 800 bp (ITS-1F/ITS-4), two bands of about 720 bp (ITS-1F/PL-R and PL-F/ITS-4), and 610 bp (PL-F/PL-R). Among 23 isolates of Phellinus species collected in Korea, Thirteen isolates were identified as Phellinus linteus based on the presence of the four bands. The other species produced only the single ITS-1F/ITS-4 product.

• Journal of Microbiology
• /
• v.39 no.1
• /
• pp.56-61
• /
• 2001

Plasmodiophora brassicae is an obligate parasite, a causal organism of clubroot disease in crucifers that can survive in the soil as resting spores for many years. P. brassicae causes great losses in susceptible varieties of crucifers throughout the world. In this present study, an in planta molecular marker for the detection of P. bassicae was developed using an oligonucleotide primer set foam the small subunit gene (18S like) and internal transcribed spacer (ITS) region of rDNA. The specific primer sequences determined were TCAGCTTGAATGCTAATGTG (ITS5) and CTACCTCATTTGAGATCCTTTGA (PB-2). This primer set was used to specifically detect p. bassicae in planta. The amplicon using the specific primer set was about 1,000 bp. However, the test plant and other soil-borne fungi including Fusarium spp. and Rhizoctonia app., as well as bacteria such as Pseudomonas app. and Erwinia sup. did not show any reaction with the primer set.

• Mycobiology
• /
• v.31 no.1
• /
• pp.23-31
• /
• 2003

With universal primer ITS1-F, the specific DHJ2 primer was developed to detect the Ectomycorrhizal(ECM) root tips in soil and to identify the species of ECM fungi, as based on DNA sequences of rDNA stored in GeneBank of NCBI. This primer was designed with the common sites of rDNA of Amanita and Boletus, and was also designed with several DNA programs provided by NCBI. The DNA fragments synthesized by PCR were calculated to be 1,000 to 1,200 bps of DNA located to 18s to 28s rDNA to contain two variable sites of ITS, indicating much diversities for specific species or ecotypes of ECM fungi. The primer DHJ2 reacted with the genomic DNA's extracted from the tissues of basidiocarp at the rate of 73 of 80 fungi collected produced single bands with a 1,100 bps length. The DNA fragment synthesized with the genomic DNA that extracted from eight ECM tips of Pinus densiflora was confirmed and analysized to the rDNAs of ECM in full sequences, and informed to be a ECM fungal species in the forest.

• Research in Plant Disease
• /
• v.20 no.1
• /
• pp.21-24
• /
• 2014

Clubroot caused by the obligate biotrophic protist Plasmodiophora brassicae Woronin is one of the most damaging diseases of Brassicaceae family. In this study, we developed species-specific primer sets for rapid and accurate detection of P. brassicae. The primer sets developed amplified a specific fragment only from P. brassicae DNA while they did not amplify a band from 10 other soilborne pathogens or from Kimchi cabbage. In sensitivity test, the species-specific primer set ITS1-1/ITS1-2 could work for approximately 10 spores/ml of genomic DNA showing more sensitivity and accuracy than previous methods. With quantitative real-time PCR test, the primer set detected less spores of P. brassicae than before, confirming that the species-specific primer set could be useful for rapid and accurate detection of P. brassicae.

• Research in Plant Disease
• /
• v.18 no.2
• /
• pp.73-79
• /
• 2012

Phytophthora katsurae is a fungal pathogen responsible for chestnut ink disease. We designed two duplex primer sets (SOPC 1F/1R+KatI 3F/5R, SOPC 1-1F/1-1R+KatI 3F/5R) to detect P. katsurae. SOPC 1F/1R and SOPC 1-1F/1-1R primer pairs were designed for sequence characteristic amplification regions (SCAR) marker, and KatI 3F/5R primer pair was used for P. katsurae-specific primer designed from internal transcribed spacer (ITS) region. To assess the sensitivity of duplex PCR, genomic DNA was serially diluted 10-fold to make the final concentrations from 1 mg/ml to 1 ng/ml. The sensitivity for two primer sets were 1 ${\mu}g/ml$ and 100 ng/ml, respectively. To find detection limits for zoospores of P. katsurae, each zoospore suspension was serially diluted 10-fold to make the final concentrations from $1{\times}10^6$ to $1{\times}10^2$ cells/ml, and then DNA was extracted. The limits of detection for all of two primer sets were $1{\times}10^5$ cells/ml. All of two primer sets were specific to P. katsurae in PCR detection and did not produce any P. katsurae-specific PCR amplicons from other 16 Phytophthora species used as the control. This study shows that duplex PCR using two primer sets might be a useful tool for rapid and efficient detection of P. katsurae.

• Mycobiology
• /
• v.37 no.4
• /
• pp.317-319
• /
• 2009

In this study, in an effort to develop a method for the molecular detection of Tricholoma matsutake in Korea from other closely related Tricholomataceae, a species-specific PCR primer pair, TmF and TmR, was designed using nuclear ribosomal intertranscribed spacer (ITS) sequences. The DTmF and DTmR sequences were 5'-CCTGACGCCAATCTTTTCA-3' and 5'- GGAGAGCAGACTTGTGAGCA-3', respectively. The PCR primers reliably amplified only the ITS sequences of T. matsutake, and not those of other species used in this study.

• Research in Plant Disease
• /
• v.11 no.1
• /
• pp.48-55
• /
• 2005

Cylindrocarpon destructans is a soil-borne plant pathogenic fungus causing root rot on ginseng and trees. Rapid and exact detection of this pathogen was practiced on ginseng seedlings by nested PCR using speciesspecific primer set. The second round of PCR amplification by Dest 1 and Dest 4 primer set formed 400 bp of species-specific fragment of C. destructans from the product of first round of amplification by ITS 1 and ITS 4 primer set. In the PCR sensitivity test based on DNA density, nested PCR detected to the limit of one fg and it meant the nested PCR could detect up to a few spores of C. destructans. Also, nested PCR made it possible to detect the pathogen from ginseng seedlings infected by replantation on artificial infested soil. Our nested PCR results using species-specific primer set could be utilized for diagnosis of root rot disease in ginseng cultivation.

• Journal of Life Science
• /
• v.9 no.1
• /
• pp.15-21
• /
• 1999

The random amplified ploymorphic DNAs (RAPD) assay is a simple and useful tool in identification of appropriate genetic markers, that requires no knowledge of target DNA sequence. RAPD products were generated directly from seaweed tissues, without prior nucleic acid extraction, of Porphyra yezoensis, Ulva pertusa and Undaria pinnatifida. The nuclear rDNA internal transcribed spacer (ITS) fragment however was not amplified directly from the seaweed tissues. Using DNA extracted by the LiCl method, both the ITS and RAPD's have been amplified by the polymerase chain reaction. RAPD of P yezoensis, thallus (n) and conchocelis (2n) produced lots of different polymorphic bands (36-50$\%$) depending on the arbitrary primers used. Difference was also observed between direct tissues amplification and DNA extracts amplification (53-57$\%$). Thus it is important to use the same ploidy of tissue for DNA extraction and as a RAPD template.

• Mycobiology
• /
• v.41 no.4
• /
• pp.252-255
• /
• 2013

Fungal pathogens have caused severe damage to the commercial production of Pleurotus eryngii, the king oyster mushroom, by reducing production yield, causing deterioration of commercial value, and shortening shelf-life. Four strains of pathogenic fungi, including Trichoderma koningiopsis DC3, Phomopsis sp. MP4, Mucor circinelloides MP5, and Cladosporium bruhnei MP6, were isolated from the bottle culture of diseased P. eryngii. A species-specific primer set was designed for each fungus from the ITS1-5.8S rDNA-ITS2 sequences. PCR using the ITS primer set yielded a unique DNA band for each fungus without any cross-reaction, proving the validity of our method in detection of mushroom fungal pathogens.