• Journal of Microbiology
• /
• v.42 no.2
• /
• pp.111-116
• /
• 2004

It is known that Bacillus subtilis glutamyl-tRNA synthetase (GluRS) mischarges E. coli $tRNA_{1}$$^{Gln}$ with glutamate in vitro. It has also been established that the expression of B. subtilis GluRS in Escherichia coli results in the death of the host cell. To ascertain whether E. coli growth inhibition caused by B. subtilis GluRS synthesis is a consequence of Glu-$tRNA_{1}$$^{Gln}$ formation, we constructed an in vivo test system, in which B. subtilis GluRS gene expression is controlled by IPTG. Such a system permits the investigation of factors affecting E. coli growth. Expression of E. coli glutaminyl-tRNA synthetase (GlnRS) also amelio-rated growth inhibition, presumably by competitively preventing $tRNA_{1}$$^{Gln}$ misacylation. However, when amounts of up to 10 mM L-glutamine, the cognate amino acid for acylation of $tRNA_{1}$$^{Gln}$, were added to the growth medium, cell growth was unaffected. Overexpression of the B. subtilis gatCAB gene encoding Glu-$tRNA^{Gln}$ amidotransferase (Glu-AdT) rescued cells from toxic effects caused by the formation of the mis-charging GluRS. This result indicates that B. subtilis Glu-AdT recognizes the mischarged E. coli Glu-$tRNA_{1}$$^{Gln}$, and converts it to the cognate Gln-$tRNA_{1}$$^{Gln}$ species. B. subtilis GluRS-dependent Glu-$tRNA_{1}$$^{Gln}$ formation may cause growth inhibition in the transformed E. coli strain, possibly due to abnormal protein synthesis.

• Korean Journal of Microbiology
• /
• v.24 no.3
• /
• pp.204-210
• /
• 1986

One clone(pANt32) carring tRNA/sup Arg/ gene was selected from Aspergillus total tRNA gene clones. The nucleotide sequences of this tRNA gene were determined by Maxam and Gilbert's chemical cleavage methods. The sequence of this tRNA gene is as follow; 5'GGCCGGCTGCCCAATTGGCAAGGCGTCTGACTACGAATCAGGAGAT TGCAGGTTCGAGCCCTGCGTGGGTCA3'. This sequence conicides with the characteristecs of other eukaryotic tRNA. Some consensus sequences (ACT-TA bow, TATTTT and T-cluster) are found in both 5'-end and 3'-end flanking regions.

• Journal of Microbiology and Biotechnology
• /
• v.11 no.2
• /
• pp.251-258
• /
• 2001

In Gram(+) bacteria and organelles in higher eukarotes, $Gln-tRNA^{Gln}$ utilized for protein biosynthesis is formed by a tRNA-dependent amino acid transformation using mischarged $Gln-tRNA^{Gln}$ as the intermediate. In this study, the gatCAB gene encoding $Gln-tRNA^{Gln}$ amidotransferase (Glu-AdT) of Staphylococcus aureus was cloned and its nucleotide sequence wa determined. The S. aureus gatCAB gene was organized in an operon structure consisting of three open reading frames (gatC, gatA, and gatB), similar to that of Bacillus subtilis. The gene sequences for the A and B subunits of$Gln-tRNA^{Gln}$ amidotransferase showed significant homology (77 and 87% homology with amino acid sequence) with the gatA and gatB genes of B. subtilis, yet the C subunit (gatC) showed a relatively lowe homology with the B. subtilis gatC gene and other orthologues. The cloned S. aureus <$Gln-tRNA^{Gln}$ amidotransferase gene was highly expressed in Escherichia coli, and the resulting crude enzyme could convert misacylated <$Gln-tRNA^{Gln}$ into $Gln-tRNA^{Gln}$ in vitro.

• Korean Journal of Environmental Biology
• /
• v.21 no.1
• /
• pp.77-85
• /
• 2003

We have examined the 16S-23S rRNA intergenic spacer regions (ISR) of Vibrio fluvialis. ISRs were PCR amplified, cloned into a plasmid vector and then sequenced. As results of ISR nucleotide sequence analysis, total of 6 clones were isolated depending on the size. The clones were different in both the number and the composition of the tRNA genes, and were designated ISR-A, ISR-E, ISR-El, ISR-lA, ISR-EKV, ISR-EKAV. ISR-A contains $tRNA^{Ala}$; ISR-lA, $tRNA^{Ile}$-$tRNA^{Ala}$; ISR-EKV, $tRNA^{GIu}$-$tRNA^{Lys}$-$tRNA^{Val}$;ISE-EKAV, $tRNA^{GIu}$-$tRNA^{Lys}$-$tRNA^{Ala}$-$tRNA^{Val}$; ISR -E and E1, $tRNA^{GIu}$ clusters. ISR-EKV was shown to be a minor type out of the six ISR types and showed a very limited homology between ISR-EKV from V, fluvialis and ISRa from other Vibrio species. Therefore ISR-EKV sequence was used to design species-specific primers to detect V, fiuvialis from other Vibrio species by PCR reaction. The specificity of the primers was examined using genomic DNA of other Vibrios as templates for PCR reaction. The result showed that PCR can be a useful method to detect V. fluvialis among Vibrio species in a single PCR reaction.

• Korean Journal of Microbiology
• /
• v.54 no.4
• /
• pp.420-427
• /
• 2018

The orthogonal pair of Saccharomyces cerevisiae tyrosyl-tRNA synthetase (Sc YRS) and a variant of E. coli initiator tRNA, fMam $tRNA_{CUA}$ which recognizes the amber stop codon is an effective tool for site-specific incorporation of unnatural amino acids into the protein in E. coli. To evolve the amber suppression activity of the orthogonal pair, we generated a mutant library of Sc YRS by randomizing two amino acids at 320 and 321 which involve recognition of the first base of anticodon in fMam $tRNA_{CUA}$. Two positive clones are selected from the library screening with chloramphenicol resistance mediated by amber suppression. They showed growth resistance against high concentration of chloramphenicol and their $IC_{50}$ values were approximately 1.7~2.3 fold higher than the wild type YRS. In vivo amber suppression assay reveals that mutant YRS-3 (mYRS-3) clone containing amino acid substitutions of P320A and D321A showed 6.5-fold higher activity of amber suppression compared with the wild type. In addition, in vitro aminoacylation kinetics of mYRS-3 also showed approximately 7-fold higher activity than the wild type, and the enhancement was mainly due to the increase of tRNA binding affinity. These results demonstrate that optimization of anticodon recognition by engineered aminoacyl tRNA synthetase improves the efficiency of unnatural amino acid incorporation in response to nonsense codon.

• Journal of Plant Biology
• /
• v.37 no.3
• /
• pp.325-332
• /
• 1994

The effects of polyamines on the activities of elongation factors EF-1 and EF-2, phenylalanyl-tRNA synthetase, and tRNA were investigated. The activities of EF-1 and EF-2 were mostly stimulated by spermidine among three kinds of polyamines. The activities of EF-1 and EF-2 were investigated in the presence of spermidine by 230 and 181%, respectively. The activity of phenylalanyl-tRNA synthetase was slightly increased in the presence of polyamines. The effect of spermine on the synthetase was higher than that of the other polyamines. The tRNA activity in the presence fo polyamines was increased by 206% with spermidine, by 144% with spermine, and by 114% with putrescine. According to these results, it is concluded that polyamines in higher plants stimulate the protein biosynthesis by promoting the activities of elongation factors EF-1 and EF-2, aminoacyl-tRNA synthetases, and tRNAs, but the effects of polyamines on the various components for protein biosynthesis are different in according to the kind of polyamines.

• IMMUNE NETWORK
• /
• v.22 no.5
• /
• pp.39.1-39.18
• /
• 2022

RNA metabolism plays a central role in regulating of T cell-mediated immunity. RNA processing, modifications, and regulations of RNA decay influence the tight and rapid regulation of gene expression during T cell phase transition. Thymic selection, quiescence maintenance, activation, differentiation, and effector functions of T cells are dependent on selective RNA modulations. Recent technical improvements have unveiled the complex crosstalk between RNAs and T cells. Moreover, resting T cells contain large amounts of untranslated mRNAs, implying that the regulation of RNA metabolism might be a key step in controlling gene expression. Considering the immunological significance of T cells for disease treatment, an understanding of RNA metabolism in T cells could provide new directions in harnessing T cells for therapeutic implications.

• BMB Reports
• /
• v.28 no.4
• /
• pp.363-367
• /
• 1995

E. coli methionyl-tRNA synthetase is one of the class I tRNA synthetases. The Tryptophane residue at the position 461 located in the C-terminal domain of the enzyme is a key amino acid for the interaction with the anticodon of $tRNA^{Met}$. W461 was replaced with other amino acids to determine the chemical requirement for the interaction with the anticodon of $tRNA^{Met}$. Saturation mutagenesis at the position 461 generated a total of 12 substitution mutants of methionyl-tRNA synthetase. All the mutants showed the same in vivo stability as the wild-type enzyme, suggesting that the amino acid substitutions did not cause severe conformational change of the protein The mutants containing tyrosine, phenylalanine, histidine and cysteine substitutions showed in vivo activity while all the other mutants did not. The comparison of the in vitro aminoacylation activities of these mutants showed that aromatic ring structure, Van der Waals volume and hydrogen bond potential of the amino acid residue at the position 461 are the major determinants for the interaction with the anticodon of $tRNA^{Met}$.

• Bulletin of the Korean Chemical Society
• /
• v.26 no.12
• /
• pp.2033-2037
• /
• 2005

In vitro selection was used to isolate $Mg^{2+}$-dependent self-cleaving ribozymes with cis-cleavage activity from a pre-tRNA library having 40-mer random sequences attached to 5'-end of E. coli $tRNA^{Phe}$. After 8 rounds of SELEX (Systematic Evolution of Ligands by Exponential Enrichment), RNA molecules which can self-cleave at the high concentration of $Mg^{2+}$ were isolated. The selected ribozymes can carry out the self-cleavage reaction in the presence of 100 mM $Mg^{2+}$ but not in 10 mM $Mg^{2+}$. The cleavage sites of the ribozymes are located at +3 and +4 of $tRNA^{Phe}$, compared with +1 position of 5'-end cleavage site of pre-tRNA by RNase P. New RNA constructs deprived of its D stem-loop, anticodon stem-loop, variable loop and T stem-loop, respectively showed the cleavage specificity identical to a ribozyme having the intact tRNA structure. Also, the new ribozyme fused with both a ribozyme and $tRNA^{Leu}$ showed the cleavage activities at the various sites within its sequences, different from two sites of position +3 and +4 observed in the ribozyme with $tRNA^{Phe}$. Our results suggest that the selected ribozyme is not structural-specific for tRNA.

• The Journal of Natural Sciences
• /
• v.9 no.1
• /
• pp.19-24
• /
• 1997

Using the PCR(polymerase chain reaction method), gone 1 of phage K11 coding for K11 phage RNA polymerase has been cloned and expressed under the control of lac promoter. K11 phage RNA polymerase was conventionally purified through the DEAE-sephacel and Affigel blue column chromatographies. The 0.2-0.3 M $NH_4Cl$ fractions of DAEA-sephacel column chromatography showed K11 phage RNA polymerase activity and further purification with Affigel blue column chromatography showed nearly single protein band on SDS-polyacryl amide gel. K11 phage RNA polymerase, which is one of the T7 group phage RNA polymerase (E. coil phage T7, T3 and Salmonella tyhimurium phage SP6 RNA polymerase), shares high degrees of homology with the other T7 group phage RNA polymerase. Previously we constructed T7 and SP6 promoter variants and revealed promoter specificity of T7 and SP6 RNA polymerase (Lee and Kang, 1993). To investigate the promoter specificity of K11 RNA polymerase in vitro K11 promoter activity was measured with SP6 promoter variants. The SP6 promoter variant share highest degrees of sequence homology with K11 promoter sequence show strongest promoter activity.