• Horticultural Science & Technology
• /
• v.34 no.3
• /
• pp.433-441
• /
• 2016

Clubroot caused by the protist Plasmodiophora brassicae is one of the most destructive diseases of Brassica crops. Developing Chinese cabbage cultivars with durable clubroot resistance (CR) is an important goal of breeding programs, which will require new genetic resources to be identified and introduced. In this study, we evaluated resistance to P. brassicae race 4 using 26 Chinese cabbage (B. rapa ssp. pekinensis ) cultivars compared to the clubroot-susceptible Chinese cabbage inbred line 'BP079' and the clubroot-resistant European turnip (B. rapa ssp. rapifera ) inbred line 'IT033820'. No symptoms of clubroot disease were found in 'IT033820' infected with P. brassicae race 4, whereas the Chinese cabbage cultivars exhibited disease symptoms to various degrees. The Chinese cabbage cultivars that were reported to be clubroot-susceptible were susceptible to P. brassicae race 4; however, seven of the 20 cultivars reported to be clubroot-resistant were susceptible to this race of P. brassicae to varying degrees. Resting spores of P. brassicae were abundant within the infected root tissues of 'BP079', as revealed by light microscopy and scanning electron microscopy (SEM), but they were not detected in root tissues of 'IT033820'. Although resting spores were not detected by light microscopy in root tissues of the clubroot-resistant Chinese cabbage cultivar 'Kigokoro 75', a few spores were observed by SEM. The $F_1$ hybrids from a cross between 'IT033820' and 'BP079' showed no disease symptoms, and all $BC_1P_1$ progenies from a cross between the $F_1$ hybrid and 'IT033820' exhibited a resistance phenotype. In the $BC_1P_2$ population from a cross between the $F_1$ hybrid and 'BP079', this trait segregated at a ratio of 3(R):1(S) (${\chi}^2=1.333$, p = 0.248) at a 5% significance level. Inoculated $BC_1P_2$ plants were either highly resistant or highly susceptible to the pathogen, indicating that the CR to race 4 of P. brassicae carried by 'IT033820' is dominant. In the $F_2$ population, this trait segregated at a ratio of 15(R):1(S) (${\chi}^2=0.152$, p = 0.696) at a 5% significance level, suggesting that CR in 'IT033820' is mainly controlled by two dominant genes. Therefore, 'IT033820' represents a promising genetic resource for developing durable CR breeding lines in Chinese cabbage.

• Ocean and Polar Research
• /
• v.24 no.3
• /
• pp.301-311
• /
• 2002

We used diatom and porewater data of two piston cores from the central subbasin and one from the western subbasin in the Bransfield Strait in the northern Antarctic Peninsula to elucidate the depositional mechanism of the layered diatom ooze. The layered diatom ooze is characterized by an abundance of organic carbon, biogenic silica, sulfde sulfur, and lower porewater sulfate concentration. This lack of pore-water sulfate concentration in the diatom ooze interval may reflect development of reducing micro-environment in which bacterially mediated sulfate reduction occurred. The negative relationship between the total organic carbon and sulfate contents, however, indicates that sulfate reduction was partly taking place but does not control organic carbon preservation in this unit. Rather, well-preserved Chaetoceros resting spores in the layered diatom ooze indicate a rapid sedimentation of the diatom as a result of repetitive iceedge blooms on the Bransfield shelf during the cold period (around 2500 yrs BP) when the permanent seaice existed on the shelf, During this period, it is expected that the downslope-flowing cold and dense water was also formed on the Bransfield shelf as a result of sea ice formation, playing an important role for the formation of layered diatom ooze in the Bransfield subbasins.

• Journal of Microbiology
• /
• v.39 no.1
• /
• pp.56-61
• /
• 2001

Plasmodiophora brassicae is an obligate parasite, a causal organism of clubroot disease in crucifers that can survive in the soil as resting spores for many years. P. brassicae causes great losses in susceptible varieties of crucifers throughout the world. In this present study, an in planta molecular marker for the detection of P. bassicae was developed using an oligonucleotide primer set foam the small subunit gene (18S like) and internal transcribed spacer (ITS) region of rDNA. The specific primer sequences determined were TCAGCTTGAATGCTAATGTG (ITS5) and CTACCTCATTTGAGATCCTTTGA (PB-2). This primer set was used to specifically detect p. bassicae in planta. The amplicon using the specific primer set was about 1,000 bp. However, the test plant and other soil-borne fungi including Fusarium spp. and Rhizoctonia app., as well as bacteria such as Pseudomonas app. and Erwinia sup. did not show any reaction with the primer set.

• Mycobiology
• /
• v.39 no.3
• /
• pp.233-234
• /
• 2011

Clubroot symptoms were frequently observed on roots of shepherd's-purse (Capsella bursa-pastoris) grown in a field in Nonsan, Chungnam province, Korea in March, 2009. Many resting spores were found in the cells of the root gall tissues collected from the field. The clubroot pathogen was identified as Plasmodiophora brassicae based on its morphological and pathological characteristics. This is the first report that P. brassicae causes clubroot of shepherd's-purse in Korea.

• Research in Plant Disease
• /
• v.18 no.3
• /
• pp.210-216
• /
• 2012

Clubroot of Chinese cabbage by Plasmodiophora brassicae, was found to be high virulent to the Chinese cabbage, turnips and cabbage. It this study, the endophytic bacteria Flavobacterium hercynium EPB-C313, which was isolated from tissues of Chinese cabbage, was investigated the antimicrobial activity on the inactivation of resting spores and its control effect on clubroot disease by bioassay. The bacterial cells, culture solutions, and culture filtrates of F. hercynium EPB-C313 inactivate the resting spores of P. brassicae with 90.4, 36.8, and 26.0%, respectively. The clubroot was inhibited with 100% by dipping the seedlings of Chinese cabbage in culture solutions of F. hercynium EPB-C313 before planting, however the chemmical 'fluazinam' was 91.7% in pot tests. Complex treatment were highly enhanced control efficacy with 63.7% at field of 50% diseased plants by soil incorporation with the pellet contains organic matter and F. hercynium EPB-C313, seedling drench of culture solution of F. hercynium EPB-C313 and soil drench with 10 days after planting. These results imply that the F. hercynium EPB-C313 is a very useful biological control agent of clubroot disease of Chinese cabbage.

• 한국균학회소식:학술대회논문집
• /
• 2016.05a
• /
• pp.25-25
• /
• 2016

Biological control has many advantages as a disease control method, particularly when compared with pesticides. One of the most important benefits is that biological control is an environmental friendly method and does not introduce pollutants into the environment. Another great advantage of this method is its selectivity. Selectivity is the important factor regarding the balance of agricultural ecosystems because a great damage to non target species can lead to the restriction of natural enemies' populations. The objective of this research was to evaluate the effects of several different bacterial isolates on the efficacy of biological control of soil borne diseases. White rot caused by Sclerotium cepivorum was reported to be severe disease of garlic and chive. The antifungal bacteria Burkholderia pyrrocinia CAB08106-4 was tested in field bioassays for its ability to suppress white rot disease. In field tests, B. pyrrocinia CAB08106-4 isolates suppressed white rot in garlic and chive, with the average control efficacies of 69.6% and 58.9%, respectively. In addition, when a culture filtrate of B. pyrrocinia CAB08106-4 was sprayed onto wounded garlic bulbs after inoculation with a Penicillium hirstum spore suspension in a cold storage room ($-2^{\circ}C$), blue mold disease on garlic bulbs was suppressed, with a control efficacy of 79.2%. These results suggested that B. pyrrocinia CAB08106-4 isolates could be used as effective biological control agents against both soil-borne and post-harvest diseases of Liliaceae. Chinese cabbage clubroot caused by Plasmodiophora brassicae was found to be highly virulent in Chinese cabbage, turnips, and cabbage. In this study, the endophytic bacterium Flavobacterium hercynium EPB-C313, which was isolated from Chinese cabbage tissues, was investigated for its antimicrobial activity by inactivating resting spores and its control effects on clubroot disease using bioassays. The bacterial cells, culture solutions, and culture filtrates of F. hercynium EPB-C313 inactivated the resting spores of P. brassicae, with the control efficacies of 90.4%, 36.8%, and 26.0%, respectively. Complex treatments greatly enhanced the control efficacy by 63.7% in a field of 50% diseased plants by incorporating pellets containing organic matter and F. hercynium EPB-C313 in soil, drenching seedlings with a culture solution of F. hercynium EPB-C313, and drenching soil for 10 days after planting. Soft rot caused by Pectobacterium carotovorum subsp. carotovorum was reported to be severe disease to Chinese cabbage in spring seasons. The antifungal bacterium, Bacillus sp. CAB12243-2 suppresses the soft rot disease on Chinese cabbage with 73.0% control efficacy in greenhouse assay. This isolate will increase the utilization of rhizobacteria species as biocontrol agents against soft rot disease of vegetable crops. Sclerotinia rot caused by Sclerotinia sclerotiorum has been reported on lettuce during winter. An antifungal isolate of Pseudomonas corrugata CAB07024-3 was tested in field bioassays for its ability to suppress scleritinia rot. This antagonistic microorganism showed four-year average effects of 63.1% of the control in the same field. Furthermore, P. corrugata CAB07024-3 has a wide antifungal spectrum against plant pathogens, including Sclerotinia sclerotiorum, Sclerotium cepivorum, Botrytis cinerea, Colletotrichum gloeosporioides, Phytophotra capsici, and Pythium myriotylum.

• The Korean Journal of Mycology
• /
• v.27 no.1 s.88
• /
• pp.66-67
• /
• 1999

Neozygites fresenii (Zygomycetes: Entomophthorales), aphid-attacking fungus, was found in June 1998 for the first time in Korea. The fungus produces the globose primary conidia with a truncate papillar and two types of the secondary conidiophores and conidia. Resting spores were not found in our specimens, but the fungal structures observed clearly distinguish the fungus from other aphid-attacking fungi, allowing inclusion in the species N. fresenii.

• Research in Plant Disease
• /
• v.13 no.1
• /
• pp.45-49
• /
• 2007

Single spores were isolated from infected roots of Chinese cabbage with a typical clubroot symptom, collected from different Chinese cabbage cultivation areas in Korea. When the single spore isolates were inoculated on Chinese cabbage, radish, turnip, kale, leaf mustard and Williams' differential varieties, among 321 roots harvested two weeks after inoculation, a visual symptom was observed on only one root and light/uncommon symptoms were done on 70 roots. These 71 individuals were homogenized and used as inocula. These inocula caused generally higher pathogenicity than that of single spore. Finally 15 isolates, with enough growth for conducting further experiment, were selected. These 15 individuals were grouped four, seven, two and two into race 1, race 4, race 9 and race 11, respectively, using Williams' differential set. It was confirmed that race 4 were dominantly present in Korea. These 15 had been obtained from roots of Chinese cabbages, radishes and turnips inoculated with single resting spores and had shown pathogenicity to Laurentian and Wilhelmsburger belong to Rutabaga in Williams' differential variety set. Therefore, we assume that such characteristic pathotypes including race 4, especially, of P. brassicae showing strong pathogenicity to Chinese cabbage, radish and turnip may be dominant in Korea.

• 한국균학회소식:학술대회논문집
• /
• 2015.05a
• /
• pp.50-50
• /
• 2015

Both agriculture and local tourism of Kagoshima prefecture where is located on the south-western region of the Japanese mainland, are the important industries. Although cabbage (Brassica oleracea) has been cultivated in recent decades in Kagoshima, clubroot disease caused by Plasmodiophora brassicae had never been observed. However, the disease in cabbage was reported in four regions last couple years. Our survey showed that one region is infested severely whereas others are slightly. In the most widely infested region, the disease was also observed in turnip rape (Brassica rapa) which is grown as ornamental plants for landscape design in early spring and important tourist attraction. Consequently, both agriculture and local tourism are damaged by clubroot. The increase of clubroot incidence in this region might be caused by significant increase of cabbage production, the expansion of cropping season throughout the year and continuous turnip rape cultivation in the same fields of cabbage for almost three decades. Therefore we are trying to estimate the risk of clubroot damage cultivation throughout the year in this region. We collected five isolates of resting spores and identified them as race 3, 4 and 9 by Williams' method, and as pathotype group 3 and 4 by classification system using clubroot resistant (CR) $F_1$ cultivars of Chinese cabbage as differential hosts as described in Hatakeyama et al.(2004). Furthermore, we found that these populations were avirulent to commercial CR cabbages. These results indicate that introduction of CR cabbage and breeding of turnip rape are the effective measures to solve our problem.

• The Korean Journal of Mycology
• /
• v.27 no.1 s.88
• /
• pp.63-65
• /
• 1999

Conidiobolus obscurus and C. thromboides (Zygomycetes: Entomophthorales), aphid-attacking fungi, were found on the Dactynotus species (Homoptera: Aphididae) in June 1998 for the first time in Korea. They produce globose primary conidia typical to the genus Conidiobolus but their dimensions are clearly distinguished. Conidiobolus thromboides produces rhizoids and conidiophores with cylindrical constriction at their apices but C. obscurus does not form rhizoids or constricted conidiophores. Resting spores were not found in our specimens of both species, but their vegetative structures observed readily allowed identification.