• Proceedings of the Korean Society for Noise and Vibration Engineering Conference
• /
• 2002.05a
• /
• pp.948-954
• /
• 2002

The structural vibration of a diesel generator set was investigated through analyses and tests. FE modeling and normal mode analysis were performed and compared with measured results for both structure components and generator set assembly. The results of component analyses were fairly well coincident with measured results but those of assembled generator set showed more or less discrepancies. Discussions were given about the uncertainties for vibration characteristics of component structures and assembled running structures especially concerning their nonlinearities and damping effects. Detailed excitation analysis fellowed by forced response analysis was done from the engine and pressure data to compare with the actual measured vibration. As results the vibration prediction for frame structures of reciprocating internal combustion engine was confirmed reliable to some extent.

• Communications for Statistical Applications and Methods
• /
• v.8 no.2
• /
• pp.483-497
• /
• 2001

When one fits a parametric density function to a data set, it is usually advisable to test the goodness of the postulated model. In this paper we study the nonparametric tests for testing the null hypothesis against general alternatives, when the null hypothesis specifies the density function up to unknown parameters. We modify the test statistic which was proposed by the first author and his colleagues. Asymptotic distribution of the modified statistic is derived and its performance is compared with some other tests through simulation.

• Proceedings of the KIEE Conference
• /
• 1997.07a
• /
• pp.127-129
• /
• 1997

In this paper, an active magnetic bearing-based motor-generator(M-G) system is designed and controlled by using DSP devices. Several experiments including start-up test, impulse test, whirl test, and generator load test are conducted using digital PID algorithm and AC power of about 58Hz, 100V, 0.8A can be generated from the M-G set.

• Journal of the Korean Operations Research and Management Science Society
• /
• v.30 no.4
• /
• pp.151-161
• /
• 2005

For Internet service providers (ISPs), there are three common types of interconnection agreements : private peering, public peering and transit. One of the most important problems for a single ISP is to determine which other ISPs to interconnect with, and under which agreements. The problem can be then to find a set of private peering providers, transit providers and Internet exchanges (IXs) when the following input data are assumed to be given : a set of BGP addresses with traffic demands, and a set of potential service providers (Private peering/transit providers and IXs) with routing information, cost functions and capacities. The objective is to minimize the total interconnection cost. We show that the problem is NP-hard, give a mixed-integer programming model, and propose a heuristic algorithm. Computational experience with a set of test instances shows the remarkable performance of the proposed algorithm of rapidly generating near-optimal solutions.

• Journal of the Institute of Electronics Engineers of Korea CI
• /
• v.41 no.4
• /
• pp.59-66
• /
• 2004

We define a SG(String Graph) and an ASG(Alive String Graph) to the purpose to do static analysis. For a life and death judgment, we apply the rule to the situation which the stone is included and not included. We define the rules that are SR(String Reduction), ER(Empty Reduction), ET(Edge Transform), and CG(Circular Graph), when the stone is not included. We define the rules that are DESR(Dead Enemy Strings Reduction) and SCSR(Same Color String Reduction), when the stone is included. We evaluate a SG that it is an ASG or not by using rules. And we use APC(Articulation Point Check) nile according to number of articulation points lot a life and death judgment. The performance of our method has been tested on the problem set IGS_31_counted form the Computer Go Test Collection. The test set contains 11,191 Points and 1,123 Strings. We obtain 92.5% accuracy of Points and 95.7% accuracy of Strings.

• Wind and Structures
• /
• v.26 no.2
• /
• pp.75-87
• /
• 2018

A large number of low-rise buildings experienced serious roof covering failures under strong wind while few suffered structural damage. Clay and concrete tiles are two main kinds of roof covering. For the tile roof system, few researches were carried out based on Finite Element (FE) analysis due to the difficulty in the simulation of the interface between the tiles and the roof sheathing (the bonding materials, foam or mortar). In this paper, the FE analysis of a single clay or concrete tile with foam-set or mortar-set were built with the interface simulated by the equivalent nonlinear springs based on the mechanical uplift and displacement tests, and they were expanded into the whole roof. A detailed wind tunnel test was carried out at Tongji University to acquire the wind loads on these two kinds of roof tiles, and then the test data were fed into the FE analysis. For the purpose of validation and calibration, the results of FE analysis were compared with the full-scale performance ofthe tile roofs under simulated strong wind impact through one-of-a-kind Wall of Wind (WoW) apparatus at Florida International University. The results are consistent with the WoW test that the roof of concrete tiles with mortar-set provided the highest resistance, and the material defects or improper construction practices are the key factors to induce the roof tiles' failure. Meanwhile, the staggered setting of concrete tiles would help develop an interlocking mechanism between the tiles and increase their resistance.

• Journal of the Korean Society for Industrial and Applied Mathematics
• /
• v.21 no.2
• /
• pp.63-73
• /
• 2017

Segmenting the image into multiple regions is at the core of image processing. Many segmentation formulations of an images with multiple regions have been suggested over the years. We consider segmentation algorithm based on the multi-phase level set method in this work. Proposed method gives the best result upon other methods found in the references. Moreover it can segment images with intensity inhomogeneity and have multiple junction. We extend our method (GLIF) in [T. Dultuya, and M. Kang, Segmentation with shape prior using global and local image fitting energy, J.KSIAM Vol.18, No.3, 225-244, 2014.] using a multiphase level set formulation to segment images with multiple regions and junction. We test our method on different images and compare the method to other existing methods.

• International Journal of Highway Engineering
• /
• v.16 no.3
• /
• pp.85-99
• /
• 2014

PURPOSES : This study has been performed with the objective to determine threshold zone luminance of adaptation luminance by target safety level in a vehicular traffic tunnel with design speed set at 100km/h. METHODS : The study made a miniature capable of portraying changes in luminance distribution within $2{\times}10^{\circ}$ conical field of view of the driver approaching to the tunnel for the test. Test conditions were set based on justifications for CIE 88-1990's threshold zone luminance used as a reference by domestic tunnel light standards (KS C 3703 : 2010). Luminance contrast of object background and object is 23%, object presentation duration is 0.5 seconds, and size of the object background is $7.3{\times}11.5m^2$ RESULTS : Threshold zone luminance was set within adaptation luminance of $100{\sim}3,000cd/m^2$. Adaptation luminance and threshold zone luminance based on 50%, 75% and 90% target safety level all showed a relatively high linear relationship. According to findings in the study, it is not appropriate to specify the relationship between adaptation luminance and threshold zone luminance as luminance ratio. Rather, direct utilization of the linear relationship gained from the study findings appears to be the better solution. CONCLUSIONS : Findings of this study may be used to determine operation of threshold zone luminance based on target safety level. However, a proper verification and validity of test results are required. Furthermore, a study to determine proper threshold zone luminance level considering target safety level reviewed in this study and various decision-making factors such as economic conditions in Korea and energy-related policies should be carried out in addition. Additional tests on adaptation luminance greater than $3,000cd/m^2$ will be performed, through which application scope of the test findings will be broadened.

• Bulletin of the Korean Chemical Society
• /
• v.33 no.4
• /
• pp.1123-1127
• /
• 2012

P-gp (P-glycoprotein) is a member of the ATP binding cassette (ABC) family of transporters. It transports many kinds of anticancer drugs out of the cell. It plays a major role as a cause of multidrug resistance (MDR). MDR function may be a cause of the failure of chemotherapy in cancer and influence pharmacokinetic properties of many drugs. Hence classification of candidate drugs as substrates or nonsubstrate of the P-gp is important in drug development. Therefore to identify whether a compound is a P-gp substrate or not, in silico method is promising. Recursive Partitioning (RP) method was explored for prediction of P-gp substrate. A set of 261 compounds, including 146 substrates and 115 nonsubstrates of P-gp, was used to training and validation. Using molecular descriptors that we can interpret their own meaning, we have established two models for prediction of P-gp substrates. In the first model, we chose only 6 descriptors which have simple physical meaning. In the training set, the overall predictability of our model is 78.95%. In case of test set, overall predictability is 69.23%. Second model with 2D and 3D descriptors shows a little better predictability (overall predictability of training set is 79.29%, test set is 79.37%), the second model with 2D and 3D descriptors shows better discriminating power than first model with only 2D descriptors. This approach will be used to reduce the number of compounds required to be run in the P-gp efflux assay.

• Journal of Microbiology
• /
• v.39 no.1
• /
• pp.56-61
• /
• 2001

Plasmodiophora brassicae is an obligate parasite, a causal organism of clubroot disease in crucifers that can survive in the soil as resting spores for many years. P. brassicae causes great losses in susceptible varieties of crucifers throughout the world. In this present study, an in planta molecular marker for the detection of P. bassicae was developed using an oligonucleotide primer set foam the small subunit gene (18S like) and internal transcribed spacer (ITS) region of rDNA. The specific primer sequences determined were TCAGCTTGAATGCTAATGTG (ITS5) and CTACCTCATTTGAGATCCTTTGA (PB-2). This primer set was used to specifically detect p. bassicae in planta. The amplicon using the specific primer set was about 1,000 bp. However, the test plant and other soil-borne fungi including Fusarium spp. and Rhizoctonia app., as well as bacteria such as Pseudomonas app. and Erwinia sup. did not show any reaction with the primer set.