• Journal of Environmental Impact Assessment
• /
• v.22 no.1
• /
• pp.1-17
• /
• 2013

Carbon sequestration on soil is one of the counter measurements against climate change in agricultural sector. Increasing incorporation of organic fertilizer would increase soil organic carbon (SOC) but it could bring high potential of nutrient losses which would result in water quality degradation. In this paper, literature review on soil organic carbon behavior according to agricultural management is presented. The results of field experiment to identify the effect of organic and commercial fertilizer applications on SOC and runoff water quality were also presented. Field experiment confirmed increased SOC and nutrient concentrations in runoff water as application rate of organic fertilizer increase. The potential use of simulation model to develop best agricultural management practice considering carbon sequestration and water quality conservation at the same time is discussed and monitoring and modeling strategies are also suggested to achieve the goal.

• Korean Journal of Environmental Agriculture
• /
• v.25 no.4
• /
• pp.306-315
• /
• 2006

Two different experiments, adsorption/desorption and runoff by rainfall simulation of four pesticides, such as alachlor, ethalfluralin, ethoprophos and pendimethalin were undertaken their runoff and erosion losses from sloped land and to assess the influence of their properties and environmental factors on them. The mobility of four pesticides and which phase they were transported by were examined in adsorption study, and the influence of rainfall pattern and sloping degree on the pesticide losses were evaluated in simulated rainfall study. Freundlich adsorption parameters (K) by the adsorption and desorption methods were 1.2 and 2.2 for ethoprophos, 1.5 and 2.6 for alachlor, respectively. And adsorption distribution coefficients (Kd) by the adsorption and desorption methods were 56 and 94 for ethalfluralin, and 104 and 189 for pendimethalin, respectively. K or Kd values of pesticides by the desorption method which were desorbed from the soil after thoroughly mixing, were higher than these ones by the adsorption method which pesticides dissolved in water were adsorbed to the soil. Another parameter (1/n), representing the linearity of adsorption, in Freundlich equation for the pesticides tested ranged from 0.96 to 1.02 by the desorption method and from 0.87 to 1.02 by the adsorption method. Therefore, the desorption method was more independent from pesticide concentration in soil solution than the adsorption method. By Soil Survey and Land Research Center (SSLRC)'s classification for pesticide mobility, alachlor and ethoprophos were classified into moderately mobile $(75{\leq}Koc<500)$, and ethalfluralin and pendimethalin were included to non-mobile class (Koc > 4000). Runoff and erosion loss of pesticides by three rainfall scenarios were from 1.0 to 6.4% and from 0.3 to 1.2% for alachlor, from 1.0 to 2.5% and from 1.7 to 10.1% for ethalfluralin, from 1.3 to 2.9% and from 3.9 to 10.8% for pendimethalin, and from 0.6 to 2.7% and from 0.1 % 0.3% for ethoprophos, respectively. Distribution of pesticides in soil profile were investigated after the simulated rainfall study. Alachlor and ethoprophos were leached to from 10 to 15 cm of soil layer, but ethalfluralin and pendimethalin were mostly remained at the top 5 cm of soil profile. The losses of the pesticides at 30% of sloping degree were from 0.2 to 1.9 times higher than those at 10%. The difference of their runoff loss was related with their concentration in runoff water while the difference of their erosion loss must be closely related with the quantity of soil eroded.

• Journal of Soil and Groundwater Environment
• /
• v.25 no.3
• /
• pp.52-64
• /
• 2020

The universal soil loss equation (USLE), a model for estimating the potential soil loss, has been used not only in research areas but also in establishing national policies in South Korea. Despite its wide applicability, USLE cannot adequately address the effect of seasonal variances. To overcome this limit, the ArcGIS-based Sediment Assessment Tool for Effective Erosion (ArcSATEEC) has been developed as an alternative model. Although the field-scale (< 100 ㎡) application of this model produced reliable estimation results, it is still challenging to validate accuracy of the model estimation because it only estimates potential soil losses, not the actual sediment yield. Therefore, in this study, a method for estimating actual soil loss based on the ArcSATEEC model was suggested. The model was applied to eight watersheds in South Korea to estimate sediment yields. Correction factor was introduced for each watershed, and the estimated sediment yield was compared with that of the estimated yield by LOAD ESTimator (LOADEST). Sediment yield estimation for all watersheds exhibited reliable results, and the validity of the proposed correction factor was confirmed, suggesting the correction factor needs to be considered in estimating actual soil loss.

• Journal of Ecology and Environment
• /
• v.38 no.3
• /
• pp.281-291
• /
• 2015

To clarify the effects of forest fire on the carbon budget of a forest ecosystem, this study compared the seasonal variation of soil respiration, net primary production and net ecosystem production (NEP) over the year in unburned and burned Pinus densiflora forest areas. The annual net carbon storage (i.e., NPP) was $5.75t\;C\;ha^{-1}$ in the unburned site and $2.14t\;C\;ha^{-1}$ in the burned site in 2012. The temperature sensitivity of soil respiration (i.e., $Q_{10}$ value) was higher in the unburned site than in the burned site. The annual soil respiration rate was estimated by the exponential regression equation with the soil temperatures continuously measured at the soil depth of 10 cm. The estimated annual soil respiration and heterotrophic respiration (HR) rates were 8.66 and $4.50t\;C\;ha^{-1}yr^{-1}$ in the unburned site and 4.08 and $2.12t\;C\;ha^{-1}yr^{-1}$ in the burned site, respectively. The estimated annual NEP in the unburned and burned forest areas was found to be 1.25 and $0.02t\;C\;ha^{-1}yr^{-1}$, respectively. Our results indicate that the differences of carbon budget and cycling between both study sites are considerably correlated with the losses of living plant biomass, insufficient nutrients and low organic materials in the forest soil due to severe damages caused by the forest fire. The burned Pinus densiflora forest area requires at least 50 years to attain the natural conditions of the forest ecosystem prior to the forest fire.

• Korean Journal of Soil Science and Fertilizer
• /
• v.38 no.3
• /
• pp.119-126
• /
• 2005

Soil erosion at Jawoon-Ri in Hongcheon highland is one of serious problems since saprolite piling on farmland has been typically practiced at 2-3 year's intervals. The objective of the case study was to survey management practices such as tillage, application of saprolite, and cultivating crops and to propose best management practices (BMP) to reduce soil loss in Jawoon-Ri, Hongcheon-Gun. Jawoon-Ri is located in the upper stream of Naerinchun. Upland areas of Jawoon 2 and 4Ri were 206.9 and 142.3 hectare, respectively. Estimation of soil loss in this study was based on USLE (Universal soil loss equation). Annual averaged soil losses were 15.6 MT per hectare in Jawoon-2Ri and 9.0 MT per hectare in Jawoon-4Ri, respectively. This case study tried to find methods to reduce soil erosion below tolerant soil loss level which is $11MT\;ha^{-1}\;yr^{-1}$. Estimated soil losses in more than 40% of uplands in Jawoon-2Ri and 4Ri were higher than tolerant soil loss level. Especially, edge of uplands undergone excessive soil erosion by concentrated runoff water. Therefore consolidation of upland edge was included as one of the proposed Best management practices BMP). The proposed BMP in this area were buffer strips, contour and mulching, diversion drain channel, grassed water-way, detour watet-way and cover crops and so on. Amounts for BMP requirements were 7,680 m for buffer strips, 123 ha (35%) for contour and mulching, 201 ha (57%) for diversion drain channel, 13,880 m for grassed water-way, 3,860 m for detour drainage, 8,365 m for sloping side consolidation and 3,492 ha for cover crops, respectively. Application of BMP are urgently needed in uplands which is direct conjunction with stream.

• Journal of Microbiology
• /
• v.39 no.1
• /
• pp.56-61
• /
• 2001

Plasmodiophora brassicae is an obligate parasite, a causal organism of clubroot disease in crucifers that can survive in the soil as resting spores for many years. P. brassicae causes great losses in susceptible varieties of crucifers throughout the world. In this present study, an in planta molecular marker for the detection of P. bassicae was developed using an oligonucleotide primer set foam the small subunit gene (18S like) and internal transcribed spacer (ITS) region of rDNA. The specific primer sequences determined were TCAGCTTGAATGCTAATGTG (ITS5) and CTACCTCATTTGAGATCCTTTGA (PB-2). This primer set was used to specifically detect p. bassicae in planta. The amplicon using the specific primer set was about 1,000 bp. However, the test plant and other soil-borne fungi including Fusarium spp. and Rhizoctonia app., as well as bacteria such as Pseudomonas app. and Erwinia sup. did not show any reaction with the primer set.

• Journal of Microbiology and Biotechnology
• /
• v.4 no.1
• /
• pp.68-74
• /
• 1994

A bacterial strain YB-70 which has powerful biocontrol activity against Fusarium solani causing plant root-rot resulting in considerable losses of many economical crops was isolated and selected from over 500 isolates from a ginseng rhizosphere in suppressive soil, and identified as a strain of Bacillus subtilis. In several biochemical and in vitro antibiosis tests on F. solani with culture filterates from B. subtilis YB-70, our data strongly indicated metabolites which mediated inhibition of the fungal growth were presumed to be heat-stable, micromolecular, and ethyl alcohol solutable antifungal substances. Suppression of root-rot by B. subtilis YB-70 was demonstrated in pot trials with eggplant (Solanum melongena L) seedlings. Treatment of the seedling with the bacterial suspension (1.7~1.9$\times$$10^5$ CFU/g) in F. solani-infested soil significantly reduced disease incidences by 68 to 76% after 25 to 30 days. The results supported that B. subtilis YB-70 have excellent potentials as a biocontrol agent.

• Proceedings of the KIEE Conference
• /
• 2006.11a
• /
• pp.405-407
• /
• 2006

The power system analysis based on the accurate impedance of the individual underground cable, which is the inter connected to a large power system, is required. A study on calculation method of impedance allowable current for underground cables. furthermore, various methods of bonding and earthing the sheath have been used for the purpose of eliminating or reducing the sheath losses. the effectes of bonding and earthing must be includied in impedances. therefore, the subject of predicting thermal performance of soil and cable systems has been received increasing attension. for these problems, this paper describes a general formulation of impedance that is based on the effect of crossbonding and earthing of the sheath on the 66kV, 132kV and 220kV underground cable systems. also the work is presented, for calculating the temperature rise of power cable and soil.

• Journal of Forest and Environmental Science
• /
• v.29 no.2
• /
• pp.138-146
• /
• 2013

The typical natural landscapes and temporal- spatial regulation of Land use change and their ecological effects at Hailun County were conducted and analyzed, based on the translated data from remote sensing images in 1986, 1996 and 2000 using GIS and landscape ecological theory. The results indicated the area of arable land, paddy field and city land increased 7,786.39 $hm^2$, 3391.18 $hm^2$ and 120.84 $hm^2$ while the area of forestry, grassland and marsh decreased 3,184.88 $hm^2$, 1,625.8 $hm^2$ and 3,994.85 $hm^2$ respectively during 14 years. Dry land is a main landscape in this area. These changes made the environmental quality worse gradually, such as land degradation, soil erosion and water and soil losses, and temperature getting warmer. This study is very important for the local ecological environment protect and agricultural sustainability and land resources sustainable using.

• Proceedings of the Korean Society of Crop Science Conference
• /
• 2017.06a
• /
• pp.322-322
• /
• 2017

To avoid drought stress under rainfed upland conditions, it is important for rice to efficiently utilize water at shallow soil layers supplied by rainfall, and access to water retained in deer soil layers. The root developmental characteristics of rice, which play important role in the adaptability to drought conditions, vary depending on the variety. Moreover, water availability for plant differs depending on the soil types that have different physical properties such as water holding capacity, permeability, capillary force, penetration resistance, etc. In this study, we evaluated growth and yield responses of rice varieties to various soil water deficit conditions under three different soil types. The experiment was conducted in a plastic greenhouse at the Kenya Agricultural and Livestock Research Organization-Mwea from October 2016 to January 2017. Two upland varieties (NERICA 1 and 4) and one lowland variety (Komboka) were grown in handmade PVC pots (15.2 cm diameter and 85.0 cm height) filled with three different types of soil collected from major rice-growing areas of the country, namely black cotton (BC), red clay (RC), and sandy clay (SC). Three watering methods, 1) supplying water only from the soil surface (W1), 2) supplying water only from the bottom of the pots (W2), and 3) supplying water both from the soil surface and the bottom of pots (W3), were imposed from 40 days after sowing to maturity. Soil water content (SWC) at 20, 40, and 60 cm depths was measured regularly. At the harvesting stage, aboveground and root samples were collected to determine total dry weight (TDW), grain yield, and root length at 0-20, 20-40, 40-60, and 60-80 cm soil layers. Irrespective of the watering methods, the greatest root development was obtained in RC, while that in BC was less than other two soils. In BC, the degree of yield reduction under W1 was less than that in RC and SC, which could be attributed to the higher water holding capacity of BC. In RC, the growth and yield reduction observed in all varieties under W1 was attributed to the severe drought stress. On the other hand, under W2, SWC at the shallow soil depth in RC was maintained because of its higher capillary force compared with BC and SC. As the result, growths and yields in RC were not suppressed under W2. In SC, deep root development was not promoted by W2 irrespective of the varieties, which resulted in significant yield losses. Under W1, the rice growth and yield in SC was decreased although shallow root development was enhanced, and the stomatal conductance was maintained higher than RC. It was suspected that W1 caused nutrients leaching in SC because of its higher permeability. Under rainfed conditions, growth and yield of rice can be strongly affected by soil types because dynamics of soil water conditions change according to soil physical properties.