Yu Na An;Chandrasekaran Murugesan;Hyowon Choi;Ki Deok Kim;Se-Chul Chun
Mycobiology
/
v.51
no.4
/
pp.195-209
/
2023
The seed borne disease such as bakanae is difficult to control. Crop yield loss caused by bakanae depending on the regions and varieties grown, ranging from 3.0% to 95.4%. Bakanae is an important disease of rice worldwide and the pathogen was identified as Fusarium fujikuroi Nirenberg (teleomorph: Gibberella fujikuroi Sawada). Currently, four Fusaria (F. fujikuroi, F. proliferatum, F. verticillioides and F. andiyazi) belonging to F. fujikuroi species complex are generally known as the pathogens of bakanae. The infection occurs through both seed and soil-borne transmission. When infection occurs during the heading stage, rice seeds become contaminated. Molecular detection of pathogens of bakanae is important because identification based on morphological and biological characters could lead to incorrect species designation and time-consuming. Seed disinfection has been studied for a long time in Korea for the management of the bakanae disease of rice. As seed disinfectants have been studied to control bakanae, resistance studies to chemicals have been also conducted. Presently biological control and resistant varieties are not widely used. The detection of this pathogen is critical for seed certification and for preventing field infections. In South Korea, bakanae is designated as a regulated pathogen. To provide highly qualified rice seeds to farms, Korea Seed & Variety Service (KSVS) has been producing and distributing certified rice seeds for producing healthy rice in fields. Therefore, the objective of the study is to summarize the recent progress in molecular identification, fungicide resistance, and the management strategy of bakanae.
The soil-borne ascomycete fungus Cylindrocarpon destructans causes ginseng root rot disease and produces various secondary metabolites such as brefeldin A and radicicol. The slow growth of this fungus compared with other plant pathogenic and saprophytic fungi in soil disturbs isolation of this fungus from soil and infected ginseng. In this study, we developed a selective medium for C. destructans using radicicol produced by this fungus. Supplementing 50 mg/L of radicicol to medium inhibited the mycelia growth of other fungi including Botrytis cinerea, Rhizoctonia solani and Alternaria panax, but did not affect the growth of C. destructans. In addition, conidia germination of other fungal species except for C. destructans was inhibited in submerged culture supplemented with radicicol. This medium provides a very efficient tool for isolating C. destructans and also can be used as an enrichment medium for this fungus.
Crops lack genetic resistance to most necrotrophic soil-borne pathogens and parasitic nematodes that are ubiquitous in agroecosystems worldwide. To overcome this disadvantage, plants recruit and nurture specific group of antagonistic microorganisms from the soil microbiome to defend their roots against pathogens and other pests. The best example of this microbe-based defense of roots is observed in disease-suppressive soils in which the suppressiveness is induced by continuously growing crops that are susceptible to a pathogen. Suppressive soils occur globally yet the microbial basis of most is still poorly described. Fusarium wilt, caused by Fusarium oxysporum f. sp. fragariae is a major disease of strawberry and is naturally suppressed in Korean fields that have undergone continuous strawberry monoculture. Here we show that members of the genus Streptomyces are the specific bacterial components of the microbiome responsible for the suppressiveness that controls Fusarium wilt of strawberry. Furthermore, genome sequencing revealed that Streptomyces griseus, which produces a novel thiopetide antibiotic, is the principal species involved in the suppressiveness. Finally, chemical-genetic studies demonstrated that S. griseus antagonizes F. oxysporum by interfering with fungal cell wall synthesis. An attack by F. oxysporum initiates a defensive "cry for help" by strawberry root and the mustering of microbial defenses led by Streptomyces. These results provide a model for future studies to elucidate the basis of microbially-based defense systems and soil suppressiveness from the field to the molecular level.
Southern blight, caused by the soil-borne fungus Sclerotium rolfsii, is a serious disease that affects many economically important crops. In this study, we selected Bacillus subtilis GJ6-14, from a total of 260 strains, to control Southern blight in pepper plants. In both seedling and plant tests, GJ6-14 significantly suppressed disease incidence and severity compared to control, furthermore, GJ6-14 demonstrated efficient colonization in the rhizosphere by maintaining the population from log 5.41 to log 3.92 in the pathogen-inoculated plants, indicating its potential as a biocontrol agent. Molecular analysis revealed up-regulation of defense-related genes, such as a 7.6-fold increase in LOX1 and 15.5-fold increase in PR1, at 72 hr after inoculation of S. rolfsii in GJ6-14-treated plants, suggesting activation of plant defense mechanisms. Overall, our findings highlight the promising role of B. subtilis GJ6-14 as a potential biocontrol agent in sustainable management of Southern blight in pepper plants.
Disease incidence of Codonopsis lanceolata was surveyed at the major cultivating fields in Chonbuk province in 1996 to 1997. The main diseases of Codonopsis lanceolata were ovserved as leaf spot caused by Septoria codonopsis, anthracnose by Glomerella cingulata, brown leaf spot by Cercospora sp., rust by Coleosporium koreanum, powdery mildew by Erysiphe sp., Fusarium wilt caused by Fusarium oxyporum, and white root rot by Sclerotium rolfsii. Anthracnose, leaf spot and brown leaf spot occurred severely on leaves from early July to late August. They were caused early fallen leaves. Fusarium wilt and white root rot occurred severely on stem and below the soil line in late August. They resulted in withering to death or chlorosis and fallen of leaves. Disease incidence of Codonopsis lanceolata was also substantially different in occurrence with a method of cultivation in late growth stage. Fusarium wilt and white root rot were more severe with a method of no support cultivation than those with a method of support cultivation with a stick. Fusarium wilt occurred 48.8% in a method of no support cultivation but 3.1% in a method of support cultivation with a stick. And white root rot occurred 18.9% in a method of no support cultivation but 0.3% in a method of no support cultivation with a stick. Thus, it proved that soil-borne diseases could be controlled support cultivation with a stick.
Barley yellow mosaic virus (BaYMV), which is transmitted by the root-inhabiting protist Polymyxa graminis, causes a soil-borne disease. In this study, we detected BaYMV from soil using two-step nested polymerase chain reaction (PCR). Specific primers based on a coat protein region of BaYMV segment RNA1 were used in the first round of amplification. Based on the sequenced amplicon, an inner primer was designed for the second round of amplification. A PCR product of 372 bp exhibited 98%-100% nucleotide sequence identity with the coat protein region of BaYMV segment RNA1. In this study, we propose an easy method for the detection of BaYMV from soil, may considerably assist in accurate fungus-transmitted virus diagnosis and subsequent disease forecasting. This is the first report on the detection of BaYMV from soil.
Plasmodiophora brassicae is an obligate parasite, a causal organism of clubroot disease in crucifers that can survive in the soil as resting spores for many years. P. brassicae causes great losses in susceptible varieties of crucifers throughout the world. In this present study, an in planta molecular marker for the detection of P. bassicae was developed using an oligonucleotide primer set foam the small subunit gene (18S like) and internal transcribed spacer (ITS) region of rDNA. The specific primer sequences determined were TCAGCTTGAATGCTAATGTG (ITS5) and CTACCTCATTTGAGATCCTTTGA (PB-2). This primer set was used to specifically detect p. bassicae in planta. The amplicon using the specific primer set was about 1,000 bp. However, the test plant and other soil-borne fungi including Fusarium spp. and Rhizoctonia app., as well as bacteria such as Pseudomonas app. and Erwinia sup. did not show any reaction with the primer set.
Proceedings of the Korean Society of Plant Pathology Conference
/
2003.10a
/
pp.89.1-89
/
2003
Disease suppression by ectomycorrhizal(ECM) fungi has been demonstrated on red pine seedlings. Culturing of pathogenic fungi on petri plates containing culture filtrates of ECM fungi showed that culture filtrates of the ECM fungus Hebeloma cylindrosporum may inhibit the mycelial growth of all tested soil-borne plant pathogenic(SBPP) fungi upto 60%, In order to examine the effects of ECM fungi on SBPP fungi and on red pine seedlings, both symbiotic and pathogenic fungi were inoculated into the soil with red pine seedlings by three inoculation methods; pre-inoculation of SBPP fungi 10 days before inoculation of ECM fungi, simultaneous inoculation of both fungi, post-inoculation of SBPP fungi 60 days after inoculation of ECM fungi. Seedling mortality, seedling growth, and ectomycorrhizal formation by the combined treatments were examined and compared. Pine seedlings were dead by the pre-inoculation of pathogenic fungi, except Rhizina undulate which required 9-12 days, within 6 days after inoculation. Among pathogenic fungi tested, Fusarium oxysporum was the most pathogenic with the mortality of 44%. However, no dead seedlings were shown by simultaneous inoculation of both fungi or pre-inoculation of ECM fungi. In addition, pine seedlings treated by simultaneous or post-inoculation of SBPP fungi were relatively higher than those treated by pre-inoculation in diameter at root crown and the number of ectomycorrhizal roots. There were no significant differences among inoculation methods in root length and dry weight of treated seedlings. It means that ECM fungi somehow play a role in protecting primary roots of red pine seedlings against invasion by the SBPP fungi.
Plant growth-promoting Psudomonas fluorescens GL20 was isolated from a ginseng rhizosphere on chrome azurol Sagar. P. fluorescens GL20 produced a large amount of hydoxamate siderophore in an iron-deficient medium. The siderophore showed significantly high specific activity of 20.2 unit. Using an in vitro antifungal test, P. fluorescens GL20 considerably suppressed growth of phytopathogenic fungus Fusarium solani, inhibiting spore germination and germ tube elongation. In pot trials of kidney beans with P. fluorescens GL20, disease incidence was remarkably reduced up to $68{\%}$ compared with that of F. solani alone, and plant growth was also increased nearly 1.6 fold as compared to that of the untreated control, promoting elongation and development of the roots. These results indicate that the plant growth-promoting activity of P. fluorescens GL20 can play an important role in biological control of soil-borne plant disease in a rhizosphere, enhancing the growth of plants.
본 웹사이트에 게시된 이메일 주소가 전자우편 수집 프로그램이나
그 밖의 기술적 장치를 이용하여 무단으로 수집되는 것을 거부하며,
이를 위반시 정보통신망법에 의해 형사 처벌됨을 유념하시기 바랍니다.
[게시일 2004년 10월 1일]
이용약관
제 1 장 총칙
제 1 조 (목적)
이 이용약관은 KoreaScience 홈페이지(이하 “당 사이트”)에서 제공하는 인터넷 서비스(이하 '서비스')의 가입조건 및 이용에 관한 제반 사항과 기타 필요한 사항을 구체적으로 규정함을 목적으로 합니다.
제 2 조 (용어의 정의)
① "이용자"라 함은 당 사이트에 접속하여 이 약관에 따라 당 사이트가 제공하는 서비스를 받는 회원 및 비회원을
말합니다.
② "회원"이라 함은 서비스를 이용하기 위하여 당 사이트에 개인정보를 제공하여 아이디(ID)와 비밀번호를 부여
받은 자를 말합니다.
③ "회원 아이디(ID)"라 함은 회원의 식별 및 서비스 이용을 위하여 자신이 선정한 문자 및 숫자의 조합을
말합니다.
④ "비밀번호(패스워드)"라 함은 회원이 자신의 비밀보호를 위하여 선정한 문자 및 숫자의 조합을 말합니다.
제 3 조 (이용약관의 효력 및 변경)
① 이 약관은 당 사이트에 게시하거나 기타의 방법으로 회원에게 공지함으로써 효력이 발생합니다.
② 당 사이트는 이 약관을 개정할 경우에 적용일자 및 개정사유를 명시하여 현행 약관과 함께 당 사이트의
초기화면에 그 적용일자 7일 이전부터 적용일자 전일까지 공지합니다. 다만, 회원에게 불리하게 약관내용을
변경하는 경우에는 최소한 30일 이상의 사전 유예기간을 두고 공지합니다. 이 경우 당 사이트는 개정 전
내용과 개정 후 내용을 명확하게 비교하여 이용자가 알기 쉽도록 표시합니다.
제 4 조(약관 외 준칙)
① 이 약관은 당 사이트가 제공하는 서비스에 관한 이용안내와 함께 적용됩니다.
② 이 약관에 명시되지 아니한 사항은 관계법령의 규정이 적용됩니다.
제 2 장 이용계약의 체결
제 5 조 (이용계약의 성립 등)
① 이용계약은 이용고객이 당 사이트가 정한 약관에 「동의합니다」를 선택하고, 당 사이트가 정한
온라인신청양식을 작성하여 서비스 이용을 신청한 후, 당 사이트가 이를 승낙함으로써 성립합니다.
② 제1항의 승낙은 당 사이트가 제공하는 과학기술정보검색, 맞춤정보, 서지정보 등 다른 서비스의 이용승낙을
포함합니다.
제 6 조 (회원가입)
서비스를 이용하고자 하는 고객은 당 사이트에서 정한 회원가입양식에 개인정보를 기재하여 가입을 하여야 합니다.
제 7 조 (개인정보의 보호 및 사용)
당 사이트는 관계법령이 정하는 바에 따라 회원 등록정보를 포함한 회원의 개인정보를 보호하기 위해 노력합니다. 회원 개인정보의 보호 및 사용에 대해서는 관련법령 및 당 사이트의 개인정보 보호정책이 적용됩니다.
제 8 조 (이용 신청의 승낙과 제한)
① 당 사이트는 제6조의 규정에 의한 이용신청고객에 대하여 서비스 이용을 승낙합니다.
② 당 사이트는 아래사항에 해당하는 경우에 대해서 승낙하지 아니 합니다.
- 이용계약 신청서의 내용을 허위로 기재한 경우
- 기타 규정한 제반사항을 위반하며 신청하는 경우
제 9 조 (회원 ID 부여 및 변경 등)
① 당 사이트는 이용고객에 대하여 약관에 정하는 바에 따라 자신이 선정한 회원 ID를 부여합니다.
② 회원 ID는 원칙적으로 변경이 불가하며 부득이한 사유로 인하여 변경 하고자 하는 경우에는 해당 ID를
해지하고 재가입해야 합니다.
③ 기타 회원 개인정보 관리 및 변경 등에 관한 사항은 서비스별 안내에 정하는 바에 의합니다.
제 3 장 계약 당사자의 의무
제 10 조 (KISTI의 의무)
① 당 사이트는 이용고객이 희망한 서비스 제공 개시일에 특별한 사정이 없는 한 서비스를 이용할 수 있도록
하여야 합니다.
② 당 사이트는 개인정보 보호를 위해 보안시스템을 구축하며 개인정보 보호정책을 공시하고 준수합니다.
③ 당 사이트는 회원으로부터 제기되는 의견이나 불만이 정당하다고 객관적으로 인정될 경우에는 적절한 절차를
거쳐 즉시 처리하여야 합니다. 다만, 즉시 처리가 곤란한 경우는 회원에게 그 사유와 처리일정을 통보하여야
합니다.
제 11 조 (회원의 의무)
① 이용자는 회원가입 신청 또는 회원정보 변경 시 실명으로 모든 사항을 사실에 근거하여 작성하여야 하며,
허위 또는 타인의 정보를 등록할 경우 일체의 권리를 주장할 수 없습니다.
② 당 사이트가 관계법령 및 개인정보 보호정책에 의거하여 그 책임을 지는 경우를 제외하고 회원에게 부여된
ID의 비밀번호 관리소홀, 부정사용에 의하여 발생하는 모든 결과에 대한 책임은 회원에게 있습니다.
③ 회원은 당 사이트 및 제 3자의 지적 재산권을 침해해서는 안 됩니다.
제 4 장 서비스의 이용
제 12 조 (서비스 이용 시간)
① 서비스 이용은 당 사이트의 업무상 또는 기술상 특별한 지장이 없는 한 연중무휴, 1일 24시간 운영을
원칙으로 합니다. 단, 당 사이트는 시스템 정기점검, 증설 및 교체를 위해 당 사이트가 정한 날이나 시간에
서비스를 일시 중단할 수 있으며, 예정되어 있는 작업으로 인한 서비스 일시중단은 당 사이트 홈페이지를
통해 사전에 공지합니다.
② 당 사이트는 서비스를 특정범위로 분할하여 각 범위별로 이용가능시간을 별도로 지정할 수 있습니다. 다만
이 경우 그 내용을 공지합니다.
제 13 조 (홈페이지 저작권)
① NDSL에서 제공하는 모든 저작물의 저작권은 원저작자에게 있으며, KISTI는 복제/배포/전송권을 확보하고
있습니다.
② NDSL에서 제공하는 콘텐츠를 상업적 및 기타 영리목적으로 복제/배포/전송할 경우 사전에 KISTI의 허락을
받아야 합니다.
③ NDSL에서 제공하는 콘텐츠를 보도, 비평, 교육, 연구 등을 위하여 정당한 범위 안에서 공정한 관행에
합치되게 인용할 수 있습니다.
④ NDSL에서 제공하는 콘텐츠를 무단 복제, 전송, 배포 기타 저작권법에 위반되는 방법으로 이용할 경우
저작권법 제136조에 따라 5년 이하의 징역 또는 5천만 원 이하의 벌금에 처해질 수 있습니다.
제 14 조 (유료서비스)
① 당 사이트 및 협력기관이 정한 유료서비스(원문복사 등)는 별도로 정해진 바에 따르며, 변경사항은 시행 전에
당 사이트 홈페이지를 통하여 회원에게 공지합니다.
② 유료서비스를 이용하려는 회원은 정해진 요금체계에 따라 요금을 납부해야 합니다.
제 5 장 계약 해지 및 이용 제한
제 15 조 (계약 해지)
회원이 이용계약을 해지하고자 하는 때에는 [가입해지] 메뉴를 이용해 직접 해지해야 합니다.
제 16 조 (서비스 이용제한)
① 당 사이트는 회원이 서비스 이용내용에 있어서 본 약관 제 11조 내용을 위반하거나, 다음 각 호에 해당하는
경우 서비스 이용을 제한할 수 있습니다.
- 2년 이상 서비스를 이용한 적이 없는 경우
- 기타 정상적인 서비스 운영에 방해가 될 경우
② 상기 이용제한 규정에 따라 서비스를 이용하는 회원에게 서비스 이용에 대하여 별도 공지 없이 서비스 이용의
일시정지, 이용계약 해지 할 수 있습니다.
제 17 조 (전자우편주소 수집 금지)
회원은 전자우편주소 추출기 등을 이용하여 전자우편주소를 수집 또는 제3자에게 제공할 수 없습니다.
제 6 장 손해배상 및 기타사항
제 18 조 (손해배상)
당 사이트는 무료로 제공되는 서비스와 관련하여 회원에게 어떠한 손해가 발생하더라도 당 사이트가 고의 또는 과실로 인한 손해발생을 제외하고는 이에 대하여 책임을 부담하지 아니합니다.
제 19 조 (관할 법원)
서비스 이용으로 발생한 분쟁에 대해 소송이 제기되는 경우 민사 소송법상의 관할 법원에 제기합니다.
[부 칙]
1. (시행일) 이 약관은 2016년 9월 5일부터 적용되며, 종전 약관은 본 약관으로 대체되며, 개정된 약관의 적용일 이전 가입자도 개정된 약관의 적용을 받습니다.