• Korean Journal Plant Pathology
• /
• v.14 no.6
• /
• pp.589-593
• /
• 1998

DNA amplification by polymerase chain reaction (PCR) was used to specifically detect Plasmodiophora brassicae, causing clubroot of crucifers. On the basis of DNA sequence informations, an oligonucleotide primer set specific for the pathogen was designed form small subunit gene (18S-like) and internal transcribed spacer (ITS) region of ribosomal DNA. Primer ITS 5/PB-C produced an amplification product of approximately 520 bp in length with DNA from P. brassicae. However, no amplification product was produced with DNAs from several soil-borne fungi, Didymella bryoniae and Rhizopus stolonifer. Using these primers, the clubroot pathogen was readily detected from infected roots of crucifers, but not from healthy roots. Southern hybridization analysis further confirmed that the amplification product was originated from P. brassicae.

• Research in Plant Disease
• /
• v.20 no.1
• /
• pp.21-24
• /
• 2014

Clubroot caused by the obligate biotrophic protist Plasmodiophora brassicae Woronin is one of the most damaging diseases of Brassicaceae family. In this study, we developed species-specific primer sets for rapid and accurate detection of P. brassicae. The primer sets developed amplified a specific fragment only from P. brassicae DNA while they did not amplify a band from 10 other soilborne pathogens or from Kimchi cabbage. In sensitivity test, the species-specific primer set ITS1-1/ITS1-2 could work for approximately 10 spores/ml of genomic DNA showing more sensitivity and accuracy than previous methods. With quantitative real-time PCR test, the primer set detected less spores of P. brassicae than before, confirming that the species-specific primer set could be useful for rapid and accurate detection of P. brassicae.

• Research in Plant Disease
• /
• v.25 no.1
• /
• pp.33-37
• /
• 2019

From 2016 to 2018, approximately 15% of kohlrabi were observed displaying significant clubroot symptoms in farmer's fields in Jeju, Korea. The initial infection appeared as hypertrophy of root hairs, and as the disease progressed, galls formation occurred on the main roots, finally disease progress resulted in yellowing and wilting of leaves. Pathogenicity was proven by artificial inoculation of plants with resting spore suspension, fulfilling Koch's postulates. The resting spore is one-celled, spherical and subspherical, colorless, and $3-5{\mu}m$ in diameter. On the basis of the morphological characteristics and phylogenetic analyses of internal transcribed spacer rDNA, the causal agent was identified as Plasmodiophora brassicae. To our knowledge, this is the first report on the occurrence of P. brassicae on kohlrabi in Korea.

• Journal of Microbiology and Biotechnology
• /
• v.14 no.1
• /
• pp.220-223
• /
• 2004

Club root caused by Plasmodiophora brassicae is found in crucifers. Among the over hundreds of Streptomyces isolated from soil in Korea. One strain showed prominent activity against P. brassicae. The strain was identified based on 16S rDNA sequencing and the morphology by a method of scanning electron microscopy. An active compound in the fermented broth obtained from the strain was separated. Even though the complete assignments of the compound remain for future work, the results regarding the isolation and characterization of the strain with a certain activity against P. brassicae are shown in this paper.

• Journal of Microbiology
• /
• v.39 no.1
• /
• pp.56-61
• /
• 2001

Plasmodiophora brassicae is an obligate parasite, a causal organism of clubroot disease in crucifers that can survive in the soil as resting spores for many years. P. brassicae causes great losses in susceptible varieties of crucifers throughout the world. In this present study, an in planta molecular marker for the detection of P. bassicae was developed using an oligonucleotide primer set foam the small subunit gene (18S like) and internal transcribed spacer (ITS) region of rDNA. The specific primer sequences determined were TCAGCTTGAATGCTAATGTG (ITS5) and CTACCTCATTTGAGATCCTTTGA (PB-2). This primer set was used to specifically detect p. bassicae in planta. The amplicon using the specific primer set was about 1,000 bp. However, the test plant and other soil-borne fungi including Fusarium spp. and Rhizoctonia app., as well as bacteria such as Pseudomonas app. and Erwinia sup. did not show any reaction with the primer set.

• Journal of Microbiology and Biotechnology
• /
• v.12 no.6
• /
• pp.1022-1025
• /
• 2002

Club root is one of the major diseases that occur in crucifers. It is caused by Plasmodiophora brassicae. In order to discover microbial biopesticides against P. brassicae, forty-eight Streptomyces isolated from soil were screened. Among these, three strains showed excellent pesticidal activities. We report results on in vivo screening with fermentation broths of these strains and identification of the strain taxa.

• Mycobiology
• /
• v.39 no.3
• /
• pp.233-234
• /
• 2011

Clubroot symptoms were frequently observed on roots of shepherd's-purse (Capsella bursa-pastoris) grown in a field in Nonsan, Chungnam province, Korea in March, 2009. Many resting spores were found in the cells of the root gall tissues collected from the field. The clubroot pathogen was identified as Plasmodiophora brassicae based on its morphological and pathological characteristics. This is the first report that P. brassicae causes clubroot of shepherd's-purse in Korea.

• Mycobiology
• /
• v.37 no.1
• /
• pp.69-71
• /
• 2009

Clubroot symptoms occurred severely on roots of Pak-Choi (Brassica campestris ssp. chinensis) grown in greenhouses in Gwangju city, Gyeonggi province, Korea in September, 2008. The incidence of the disease symptoms reached as high as 90% in three greenhouses investigated. The root galls collected from the greenhouses were sectioned using a scalpel and observed by light microscope. Many resting spores were found in the cells of the root gall tissues. Suspension of resting spores was prepared from the root galls and inoculated to roots of healthy Pak-Choi plants. Each of five resting spore suspensions caused clubroot symptoms on the roots, which were similar to those observed during the greenhouse survey. Resting spores of the pathogen were observed in the cells of the affected roots. The clubroot pathogen was identified as Plasmodiophora brassicae based on its morphological and pathological characteristics. This is the first report that Plasmodiophora brassicae causes clubroot of Pak-Choi.

• The Korean Journal of Mycology
• /
• v.43 no.4
• /
• pp.286-289
• /
• 2015

Clubroot, caused by the obligate parasite Plasmodiophora brassicae, is a severe soilborne disease of Brassicaceae. Storage of clubroot gall is important for studies on pathogenicity and race identification. As the current storage method has been used for more than 100 years, a new storage method should be developed and the most efficient way maintaining pathogenicity should be determined. Effects of storage conditions with different storage periods on pathogenicity in galls of kimchi cabbage were examined in a greenhouse. The experiments were performed under six conditions and four temperatures in order to determine the most effective storage conditions for maintenance of pathogenicity. The most effective conditions for clubroot gall storage was the storage of whole gall at $-70^{\circ}C$ or storage of filtrate at the same temperature through eight layers of gauze after homogenization of the galls.

• The Plant Pathology Journal
• /
• v.18 no.5
• /
• pp.266-270
• /
• 2002

Inbred lines of Chinese cabbage KU-101 (resistant line against Plasmodiophora brassicae race race 6) and CS-113 (susceptible line) were crossed and their progeny lines F$_1$, BC$_1$F$_1$, F$_2$, and F$_3$ were produced for the construction of the genetic linkage map of R brassicae race 6-resistant Brassica campestris ssp. pekinensis genome. Restriction fragment length polymorphism (RFLP) was applied to compare between parents and their f$_2$ progenies with a total of 192 probes and 5 restriction enzymes. The constructed RFLP map covered 1,104 cM with a mean distance between genetic marker of 8.0 cM, and produced 10 linkage groups having 121 genetic loci. The loci of P. brassicae race 6 (CR6)-resistant Brassica genome were determined by interval mapping of quan-titative trait loci (QTL), which resulted from bioassay using the same race of the fungi in P3 population. Resistant loci were estimated in numbers 1 (Gl) and 3 (G3) linkage groups. In the regression test, Gl had a value of4.8 logarithm of odd (LOD) score, while C3 had values of 4.2-7.2. Given these results, the location of the CR6-resistant loci within the Brassica genome map can now be addressed.