• 한국식물병리학회지
• /
• 제14권6호
• /
• pp.589-593
• /
• 1998

DNA amplification by polymerase chain reaction (PCR) was used to specifically detect Plasmodiophora brassicae, causing clubroot of crucifers. On the basis of DNA sequence informations, an oligonucleotide primer set specific for the pathogen was designed form small subunit gene (18S-like) and internal transcribed spacer (ITS) region of ribosomal DNA. Primer ITS 5/PB-C produced an amplification product of approximately 520 bp in length with DNA from P. brassicae. However, no amplification product was produced with DNAs from several soil-borne fungi, Didymella bryoniae and Rhizopus stolonifer. Using these primers, the clubroot pathogen was readily detected from infected roots of crucifers, but not from healthy roots. Southern hybridization analysis further confirmed that the amplification product was originated from P. brassicae.

• 식물병연구
• /
• 제20권1호
• /
• pp.21-24
• /
• 2014

Plasmodiophora brassicae는 십자화과 작물에 뿌리혹병을 일으키는 주요 병원균이다. 본 연구에서는 뿌리혹병균의 신속 정확한 검출을 위해서 뿌리혹병균에 대한 새로운 종 특이적 프라이머를 개발하고자 하였다. 새롭게 개발된 프라이머들은 10종의 주요 토양병원균을 비롯하여 기주인 배추 DNA와는 반응하지 않고 P. brassicae와만 반응하는 특이성을 갖고 있었다. 그 가운데 Primer ITS1-1/1-2는 민감도 검정 결과, 10 spores/ml의 DNA까지 검출이 가능함으로써, first round PCR용임에도 불구하고 이전의 검출법 보다 감도가 높고 정확한 결과를 얻었다. Quantitative real-time PCR로 분석할 경우에는 더 적은 수의 포자까지 안정적으로 검출해 낼 수 있어 새로운 P. brassicae 종 특이적 프라이머로서의 유용성을 확인할 수 있었다.

• 식물병연구
• /
• 제25권1호
• /
• pp.33-37
• /
• 2019

2016년부터 2018년까지 제주도내 농가포장에서 재배되고 있는 콜라비에 뿌리혹병 지속적으로 발생(최고발병률 27.2%)했다. 초기 감염은 뿌리털 부분이 정상주 뿌리털에 비해 비대했으며, 병이 진전되면서 뿌리 중심부에 혹이 형성되고, 잎이 시들고 끝이 누렇게 변했다. P. brassicae 휴면포자 현탁액을 이용한 병원성 검정결과 접종 50일 후에 병원성을 나타냈다. 병원균은 콜라비 세포조직 안에 빈 곳 없이 무수히 많은 휴면포자를 형성하며, 휴면포자는 단세포로 무색, 원형 또는 타원형, 크기는 직경 $3-5{\mu}m$이다. 콜라비 뿌리혹병원균의 ITS rDNA 염기서열 분석, 계통수 작성 결과 P. brassicae로 동정했다. 따라서 균학적 특징, 병원성 검정, ITS rDNA 염기서열 비교분석 등의 결과를 바탕으로 이 병은 우리나라에서 지금까지 보고되지 않은 'Plasmodiophora brassicae에 의한 콜라비 뿌리혹병'으로 명명하고자 한다.

• Journal of Microbiology and Biotechnology
• /
• 제14권1호
• /
• pp.220-223
• /
• 2004

Club root caused by Plasmodiophora brassicae is found in crucifers. Among the over hundreds of Streptomyces isolated from soil in Korea. One strain showed prominent activity against P. brassicae. The strain was identified based on 16S rDNA sequencing and the morphology by a method of scanning electron microscopy. An active compound in the fermented broth obtained from the strain was separated. Even though the complete assignments of the compound remain for future work, the results regarding the isolation and characterization of the strain with a certain activity against P. brassicae are shown in this paper.

• Journal of Microbiology
• /
• 제39권1호
• /
• pp.56-61
• /
• 2001

Plasmodiophora brassicae is an obligate parasite, a causal organism of clubroot disease in crucifers that can survive in the soil as resting spores for many years. P. brassicae causes great losses in susceptible varieties of crucifers throughout the world. In this present study, an in planta molecular marker for the detection of P. bassicae was developed using an oligonucleotide primer set foam the small subunit gene (18S like) and internal transcribed spacer (ITS) region of rDNA. The specific primer sequences determined were TCAGCTTGAATGCTAATGTG (ITS5) and CTACCTCATTTGAGATCCTTTGA (PB-2). This primer set was used to specifically detect p. bassicae in planta. The amplicon using the specific primer set was about 1,000 bp. However, the test plant and other soil-borne fungi including Fusarium spp. and Rhizoctonia app., as well as bacteria such as Pseudomonas app. and Erwinia sup. did not show any reaction with the primer set.

• Journal of Microbiology and Biotechnology
• /
• 제12권6호
• /
• pp.1022-1025
• /
• 2002

Club root is one of the major diseases that occur in crucifers. It is caused by Plasmodiophora brassicae. In order to discover microbial biopesticides against P. brassicae, forty-eight Streptomyces isolated from soil were screened. Among these, three strains showed excellent pesticidal activities. We report results on in vivo screening with fermentation broths of these strains and identification of the strain taxa.

• Mycobiology
• /
• 제39권3호
• /
• pp.233-234
• /
• 2011

Clubroot symptoms were frequently observed on roots of shepherd's-purse (Capsella bursa-pastoris) grown in a field in Nonsan, Chungnam province, Korea in March, 2009. Many resting spores were found in the cells of the root gall tissues collected from the field. The clubroot pathogen was identified as Plasmodiophora brassicae based on its morphological and pathological characteristics. This is the first report that P. brassicae causes clubroot of shepherd's-purse in Korea.

• Mycobiology
• /
• 제37권1호
• /
• pp.69-71
• /
• 2009

Clubroot symptoms occurred severely on roots of Pak-Choi (Brassica campestris ssp. chinensis) grown in greenhouses in Gwangju city, Gyeonggi province, Korea in September, 2008. The incidence of the disease symptoms reached as high as 90% in three greenhouses investigated. The root galls collected from the greenhouses were sectioned using a scalpel and observed by light microscope. Many resting spores were found in the cells of the root gall tissues. Suspension of resting spores was prepared from the root galls and inoculated to roots of healthy Pak-Choi plants. Each of five resting spore suspensions caused clubroot symptoms on the roots, which were similar to those observed during the greenhouse survey. Resting spores of the pathogen were observed in the cells of the affected roots. The clubroot pathogen was identified as Plasmodiophora brassicae based on its morphological and pathological characteristics. This is the first report that Plasmodiophora brassicae causes clubroot of Pak-Choi.

• 한국균학회지
• /
• 제43권4호
• /
• pp.286-289
• /
• 2015

순활물기생체인 Plasmodiophora brassicae는 병원성 검정을 위해서 반드시 뿌리혹을 장기적으로 보관하는 것이 매우 중요하기 때문에 그동안 병원성을 유지하는 것이 관건이다. 특히 기존의 방법은 100년 이상 사용되어온 저장법으로 개선이 필요하여 그 효율적인 방법을 밝히고자 하였다. 이 결과 장기적으로 병원성의 저하를 최소화하며 장기간 뿌리혹을 저장할 수 있는 방법은 $-70^{\circ}C$ 냉동고에 보관하는 것으로 확인되었고, 저장 조건은 뿌리혹을 그대로 보관하거나 뿌리혹을 갈아 균질화한 후 여러 겹의 거즈에 거른 것이 6가지 저장조건 중에 가장 효과적인 저장법으로 밝혀졌다.

• The Plant Pathology Journal
• /
• 제18권5호
• /
• pp.266-270
• /
• 2002

Inbred lines of Chinese cabbage KU-101 (resistant line against Plasmodiophora brassicae race race 6) and CS-113 (susceptible line) were crossed and their progeny lines F$_1$, BC$_1$F$_1$, F$_2$, and F$_3$ were produced for the construction of the genetic linkage map of R brassicae race 6-resistant Brassica campestris ssp. pekinensis genome. Restriction fragment length polymorphism (RFLP) was applied to compare between parents and their f$_2$ progenies with a total of 192 probes and 5 restriction enzymes. The constructed RFLP map covered 1,104 cM with a mean distance between genetic marker of 8.0 cM, and produced 10 linkage groups having 121 genetic loci. The loci of P. brassicae race 6 (CR6)-resistant Brassica genome were determined by interval mapping of quan-titative trait loci (QTL), which resulted from bioassay using the same race of the fungi in P3 population. Resistant loci were estimated in numbers 1 (Gl) and 3 (G3) linkage groups. In the regression test, Gl had a value of4.8 logarithm of odd (LOD) score, while C3 had values of 4.2-7.2. Given these results, the location of the CR6-resistant loci within the Brassica genome map can now be addressed.