• 제목/요약/키워드: ITS2 Primer

검색결과 191건 처리시간 0.03초

PCR 기법을 이용한 2009년 우리나라 서해안과 남해안 바지락, Ruditapes philippinarum의 Perkinsus olseni 감염에 관한 보고 (Survey of Perkinsus olseni infection in Manila clam, Ruditapes philippinarum in 2009 on the west and south coast of Korea using PCR technique)

  • 이남실;황지연;최동림;박명애
    • 한국어병학회지
    • /
    • 제23권2호
    • /
    • pp.145-153
    • /
    • 2010
  • 내용은 2009년 하반기, 우리나라 남해안(고흥, 나로도)과 서해안(선재도, 파도리)의 네 지점에서 시료채취 한 바지락에서의 Perkinsus olseni 감염에 대한 모니터링 결과로, 이전에 국제수역사무국(OIE)의 manual에서 지정하던 P. olseni에 대하여 특이적인 primer set으로 사용한 PCR 분석 결과와 2009년에 새로이 지정하는 P. olseni에 대하여 특이적인 primer set을 사용한 분석 결과를 비교하고, 결과를 통한 P. olseni의 검출율을 조사하였다. 특히 2009년에 새로이 지정된 PolsITS-140F와 PolsITS-600R의 primer set을 사용한 결과는 신속한 검출여부 분석에 적합한 것으로 생각되었다. P. olseni의 검출경향은 파도리에서 가장 낮았으며, 고흥에서 가장 높았다. 파도리의 7월, 8월 그리고 12월의 결과를 제외하고는 전 지점에서 7월에서 12월까지 지속적으로 높은 검출율을 나타내었다. PolsITS-140F와 PolsITS-600R의 primer set을 이용한 PCR 산물의 염기서열을 분석한 결과, 선재도의 결과에서 두 군데의 염기차이를 나타내는 것 이외에는 모두 같은 것으로 확인되었다.

형태적.분자생물학적 방법에 의한 Phellinus linteus의 동정에 관한 연구 (Identification of Phellinus linteus by Morphological Characteristics and Molecular Analysis)

  • 김상희;김수호;성재모
    • 한국균학회지
    • /
    • 제27권5호
    • /
    • pp.337-340
    • /
    • 1999
  • rDNA내의 ITS region의 염기서열 분석 결과를 토대로 19종의 Phellinus 속균중 Phellinus linteus를 특이적으로 동정할 수 있는 primer를 제작하였다. 이 특이 primer는 ITS1과 ITS2내에 위치하며 이들 spacer region에 인접해 있는 universal Primer내에 위치해 있다. 총 4개의 Primer(universal primer인 ITS-1F와 ITS-4 그리고 특이 primer인 PL-F와 PL-R)가 한국에서 채집된 Phellinus 속균중 Phellinus linteus를 동정하는데 사용되었다. Phellinus linteus의 증폭된 DNA크기는 800bp(ITS-1F/ITS-4)와 720 bp(ITS-1F/PL-R과 PL-F/ITS-4)에 해당하는 2개의 band, 그리고 610 bp(PL-F/PL-R)인 것으로 나타났다. 한국에서 채집된 23종의 Phellinus속균중 13종이 Phellinus linteus인 것으로 확인되었다.

  • PDF

밤나무 잉크병균, Phytophthora katsurae의 검출을 위한 Duplex PCR (A Duplex PCR for Detection of Phytophthora katsurae Causing Chestnut Ink Disease)

  • 이동현;이선근;김혜정;이상현;이상용;이종규
    • 식물병연구
    • /
    • 제18권2호
    • /
    • pp.73-79
    • /
    • 2012
  • Phytophthora katsurae는 밤나무 잉크병의 원인이 되는 병원성 균류이다. P. katsurae를 검출하기 위하여 2개의 duplex PCR primer set을 제작하였다(SOPC 1F/1R+KatI 3F/5R, SOPC 1-1F/1-1R+KatI 3F/5R). SOPC 1F/1R과 SOPC 1-1F/1-1R primer pair는 sequence characteristic amplification regions(SCAR)를 이용하여 제작하였고, KatI 3F/5R primer pair는 internal transcribed spacer(ITS) 부위로부터 제작하였다. 추출한 genomic DNA를 1 mg/ml에서 1 ng/ml까지 10배씩 순차적으로 희석하여 균사량에 따른 Duplex PCR의 민감도를 확인한 결과, 2개의 primer set은 각각 1 ${\mu}g/ml$와 100 ng/ml까지 검출이 가능하였다. 유주포자를 $1{\times}10^6$부터 $1{\times}10^2$ cells/ml까지 10배씩 순차적으로 희석하고 genomic DNA를 추출하여 P. katsurae의 유주포자량에 의한 검출 한계를 확인한 결과, 2개의 primer set 모두 $1{\times}10^5$ cells/ml까지 검출할 수 있었다. 각각의 primer set은 PCR 검출을 실시하였을 때 P. katsurae 균주에서만 PCR 산물이 증폭된 반면에, Phytophthora 16종에서는 P. katsurae에 특이적인 PCR 증폭산물이 생성되지 않았다. 따라서, 2개의 primer set을 이용한 Duplex PCR은 P. katsurae의 신속하고 효과적인 검출에 유용하게 활용될 수 있을 것이다.

ITS Primers with Enhanced Specificity to Detect the Ectomycorrhizal Fungi in the Roots of Wood Plants

  • Kim, Dong-Hun;Chung, Hung-Chae;Ohga, Shoji;Lee, Sang-Sun
    • Mycobiology
    • /
    • 제31권1호
    • /
    • pp.23-31
    • /
    • 2003
  • With universal primer ITS1-F, the specific DHJ2 primer was developed to detect the Ectomycorrhizal(ECM) root tips in soil and to identify the species of ECM fungi, as based on DNA sequences of rDNA stored in GeneBank of NCBI. This primer was designed with the common sites of rDNA of Amanita and Boletus, and was also designed with several DNA programs provided by NCBI. The DNA fragments synthesized by PCR were calculated to be 1,000 to 1,200 bps of DNA located to 18s to 28s rDNA to contain two variable sites of ITS, indicating much diversities for specific species or ecotypes of ECM fungi. The primer DHJ2 reacted with the genomic DNA's extracted from the tissues of basidiocarp at the rate of 73 of 80 fungi collected produced single bands with a 1,100 bps length. The DNA fragment synthesized with the genomic DNA that extracted from eight ECM tips of Pinus densiflora was confirmed and analysized to the rDNAs of ECM in full sequences, and informed to be a ECM fungal species in the forest.

Development of an In Planta Molecular Marker for the Detection of Chinese Cabbage (Brassica campestris ssp. pekinensis) Club Root Pathogen Plasmodiophora brassicae

  • Kim, Hee-Jong;Lee, Youn-Su
    • Journal of Microbiology
    • /
    • 제39권1호
    • /
    • pp.56-61
    • /
    • 2001
  • Plasmodiophora brassicae is an obligate parasite, a causal organism of clubroot disease in crucifers that can survive in the soil as resting spores for many years. P. brassicae causes great losses in susceptible varieties of crucifers throughout the world. In this present study, an in planta molecular marker for the detection of P. bassicae was developed using an oligonucleotide primer set foam the small subunit gene (18S like) and internal transcribed spacer (ITS) region of rDNA. The specific primer sequences determined were TCAGCTTGAATGCTAATGTG (ITS5) and CTACCTCATTTGAGATCCTTTGA (PB-2). This primer set was used to specifically detect p. bassicae in planta. The amplicon using the specific primer set was about 1,000 bp. However, the test plant and other soil-borne fungi including Fusarium spp. and Rhizoctonia app., as well as bacteria such as Pseudomonas app. and Erwinia sup. did not show any reaction with the primer set.

  • PDF

배추 뿌리혹병균 Plasmodiophora brassicae의 종 특이적 프라이머 개발 (Development of Species-Specific Primers for Plasmodiophora brassicae, Clubroot Pathogen of Kimchi Cabbage)

  • 최진수;양슬기;송정영;김홍기
    • 식물병연구
    • /
    • 제20권1호
    • /
    • pp.21-24
    • /
    • 2014
  • Plasmodiophora brassicae는 십자화과 작물에 뿌리혹병을 일으키는 주요 병원균이다. 본 연구에서는 뿌리혹병균의 신속 정확한 검출을 위해서 뿌리혹병균에 대한 새로운 종 특이적 프라이머를 개발하고자 하였다. 새롭게 개발된 프라이머들은 10종의 주요 토양병원균을 비롯하여 기주인 배추 DNA와는 반응하지 않고 P. brassicae와만 반응하는 특이성을 갖고 있었다. 그 가운데 Primer ITS1-1/1-2는 민감도 검정 결과, 10 spores/ml의 DNA까지 검출이 가능함으로써, first round PCR용임에도 불구하고 이전의 검출법 보다 감도가 높고 정확한 결과를 얻었다. Quantitative real-time PCR로 분석할 경우에는 더 적은 수의 포자까지 안정적으로 검출해 낼 수 있어 새로운 P. brassicae 종 특이적 프라이머로서의 유용성을 확인할 수 있었다.

Molecular Detection of Phellinus linteus and P. baumii by PCR Specific Primer

  • Nam, Byung-Hyouk;Kim, Gi-Young;Park, Hyung-Sik;Lee, Sang-Joon;Lee, Jae-Dong
    • Mycobiology
    • /
    • 제30권4호
    • /
    • pp.197-201
    • /
    • 2002
  • Specific primer sets based on ribosomal DNA(rDNA) internal transcribed specer(ITS) sequences were designed for rapid detection of Phellinus linteus and P. baumii. Polymerase chain reaction(PCR) with these primers produced unique bands for each Phellinus species. The annealing temperature range is from $40^{\circ}C\;to\;55^{\circ}C$. The length of PCR products(P. linteus and P. baumii) using designed combinative primer sets of PL1F, PL2R, PB1F, PB2R, ITS5F and ITS4R, were from 520 by to 730 bp. Fifteen strains of Phellinus species including P. linteus, P. baumii, P. weirianus, P. johnsonianus, P. rhabarberinus, P. pini, P. gilvus, P. igniarius, P. nigricans and P. laevigatus were examined in this study. Five strains, including two isolated strains of P. linteus(MPNU 7001 and MPNU 7002), and two isolated strains of P. baumii(MPNU 7004 and MPNU 7005) were shown to have about 520 bp (PL1F-PL2R), 700 bp (TTS5F-PL2R) and 600 bp (PB1F-ITS4R) -sized PCR single bands respectively. This molecular genetic technique provided a useful method for rapid detection and identification of P. linteus and P. baumii.

Nested PCR 기법을 이용한 인삼 뿌리썩음병원균의 특이적 검출 (Specific Detection of Root Rot Pathogen, Cylindrocarpon destructans, Using Nested PCR from Ginseng Seedlings)

  • 장창순;이정주;김선익;송정영;유성준;김홍기
    • 식물병연구
    • /
    • 제11권1호
    • /
    • pp.48-55
    • /
    • 2005
  • Cylindrocarpon destructans는 인삼 및 수목에 뿌리썩음병을 일으키는 토양 전염병 식물병원균이다. 신속 정확한 검출 가능성을 알아보기 위하여 종 특이적인 primer와 nested PCR 기법을 활용하여 인삼 유묘로부터 뿌리썩음 병균 C. destructans로 2차 PCR증폭을 실시한 결과 병원성이 확인된 C.destructans에서만 400bp의 종특이적 증폭산물을 얻을 수 있었다. 종 특이성 primer 와 nested PCR 기법을 이용한 인삼뿌리썩음병균 DNA에 대한 반응 민감도는 최저 약 1fg으로 나타나 단 몇 개의 포자만 존재해도 검출이 가능하였다. 또한, nested PCR 기법은 실제 이병토양에 심었을 경우에도 C.destructans 에 감염된 인삼 유묘로부터만 정확하게 병원균을 검출해 내었다. 종특이적 primer 와 nested PCR 기법을 이용한 본 연구 결과는 실제 재배농가에서 인삼 경작시 뿌리썩음병 진단에 매우 유용하게 활용될 수 있을 것으로 판단된다.

Isolation of Fungal Pathogens to an Edible Mushroom, Pleurotus eryngii, and Development of Specific ITS Primers

  • Kim, Sang-Woo;Kim, Sinil;Lee, Hyun-Jun;Park, Ju-Wan;Ro, Hyeon-Su
    • Mycobiology
    • /
    • 제41권4호
    • /
    • pp.252-255
    • /
    • 2013
  • Fungal pathogens have caused severe damage to the commercial production of Pleurotus eryngii, the king oyster mushroom, by reducing production yield, causing deterioration of commercial value, and shortening shelf-life. Four strains of pathogenic fungi, including Trichoderma koningiopsis DC3, Phomopsis sp. MP4, Mucor circinelloides MP5, and Cladosporium bruhnei MP6, were isolated from the bottle culture of diseased P. eryngii. A species-specific primer set was designed for each fungus from the ITS1-5.8S rDNA-ITS2 sequences. PCR using the ITS primer set yielded a unique DNA band for each fungus without any cross-reaction, proving the validity of our method in detection of mushroom fungal pathogens.

해조류로부터 Arbitrary 및 ITS Primer들을 사용한 직접 PCR 유전자 증폭반응의 한계 (Limits of Direct PCR Amplification from Seaweeds Using Arbitrary and ITS Primers)

  • 김용국;진형주;박선미;진덕희;홍용기
    • 생명과학회지
    • /
    • 제9권1호
    • /
    • pp.15-21
    • /
    • 1999
  • PCR 기법을 응용한 RAPD 방법은 대상 생물의 유전정보를 전혀 모르는 상태에도 arbitrary primer를 이용하여 증폭함으로써 생물 종간의 유전적 표식자를 확인할 수 있는 간편하고 유익한 유전분석 방법이다. 이같은 RAPD 방법을 이용하여 해조류 방사무늬 김, 미역, 구멍갈파래에 대하여 DNA를 추출하지 않고 직접 생 엽체 및 생 사상체, 생 배우체를 PCR template로 사용하여 PCR product를 생산하였다. 그러나 specific primer를 이용한 nulear r DNA의 internal trancribed spacer (ITS) 부위는 생성물을 만들지 못하였다. 간편한 LiCl 방법에 의하여 추출된 DNA를 사용하였을 때는 IST 및 RAPD 모두 PCR product를 생산하였다. 방사무늬 김의 엽체 (haploid)와 사상체 (dip-loid)로 부터의 ITS 생성물은 동일하였으나 RAPD 생성물은 사용한 arbitrary primer에 따라 36-50$\%$의 다른 band가 만들어졌다. 또한 직접 생 조직을 사용하였을때와 추출 DNA를 사용하였을 때도 53-57$\%$의 다른 band가 만들어 줬다. 그러므로 RAPD 방법으로 유전분석 실험에는 동일한 ploidy의 조직을 template로서 사용하는 것이 중요하다.

  • PDF