• 제목/요약/키워드: ITS-specific primer

검색결과 145건 처리시간 0.025초

배추 뿌리혹병균 Plasmodiophora brassicae의 종 특이적 프라이머 개발 (Development of Species-Specific Primers for Plasmodiophora brassicae, Clubroot Pathogen of Kimchi Cabbage)

  • 최진수;양슬기;송정영;김홍기
    • 식물병연구
    • /
    • 제20권1호
    • /
    • pp.21-24
    • /
    • 2014
  • Plasmodiophora brassicae는 십자화과 작물에 뿌리혹병을 일으키는 주요 병원균이다. 본 연구에서는 뿌리혹병균의 신속 정확한 검출을 위해서 뿌리혹병균에 대한 새로운 종 특이적 프라이머를 개발하고자 하였다. 새롭게 개발된 프라이머들은 10종의 주요 토양병원균을 비롯하여 기주인 배추 DNA와는 반응하지 않고 P. brassicae와만 반응하는 특이성을 갖고 있었다. 그 가운데 Primer ITS1-1/1-2는 민감도 검정 결과, 10 spores/ml의 DNA까지 검출이 가능함으로써, first round PCR용임에도 불구하고 이전의 검출법 보다 감도가 높고 정확한 결과를 얻었다. Quantitative real-time PCR로 분석할 경우에는 더 적은 수의 포자까지 안정적으로 검출해 낼 수 있어 새로운 P. brassicae 종 특이적 프라이머로서의 유용성을 확인할 수 있었다.

형태적.분자생물학적 방법에 의한 Phellinus linteus의 동정에 관한 연구 (Identification of Phellinus linteus by Morphological Characteristics and Molecular Analysis)

  • 김상희;김수호;성재모
    • 한국균학회지
    • /
    • 제27권5호
    • /
    • pp.337-340
    • /
    • 1999
  • rDNA내의 ITS region의 염기서열 분석 결과를 토대로 19종의 Phellinus 속균중 Phellinus linteus를 특이적으로 동정할 수 있는 primer를 제작하였다. 이 특이 primer는 ITS1과 ITS2내에 위치하며 이들 spacer region에 인접해 있는 universal Primer내에 위치해 있다. 총 4개의 Primer(universal primer인 ITS-1F와 ITS-4 그리고 특이 primer인 PL-F와 PL-R)가 한국에서 채집된 Phellinus 속균중 Phellinus linteus를 동정하는데 사용되었다. Phellinus linteus의 증폭된 DNA크기는 800bp(ITS-1F/ITS-4)와 720 bp(ITS-1F/PL-R과 PL-F/ITS-4)에 해당하는 2개의 band, 그리고 610 bp(PL-F/PL-R)인 것으로 나타났다. 한국에서 채집된 23종의 Phellinus속균중 13종이 Phellinus linteus인 것으로 확인되었다.

  • PDF

ITS Primers with Enhanced Specificity to Detect the Ectomycorrhizal Fungi in the Roots of Wood Plants

  • Kim, Dong-Hun;Chung, Hung-Chae;Ohga, Shoji;Lee, Sang-Sun
    • Mycobiology
    • /
    • 제31권1호
    • /
    • pp.23-31
    • /
    • 2003
  • With universal primer ITS1-F, the specific DHJ2 primer was developed to detect the Ectomycorrhizal(ECM) root tips in soil and to identify the species of ECM fungi, as based on DNA sequences of rDNA stored in GeneBank of NCBI. This primer was designed with the common sites of rDNA of Amanita and Boletus, and was also designed with several DNA programs provided by NCBI. The DNA fragments synthesized by PCR were calculated to be 1,000 to 1,200 bps of DNA located to 18s to 28s rDNA to contain two variable sites of ITS, indicating much diversities for specific species or ecotypes of ECM fungi. The primer DHJ2 reacted with the genomic DNA's extracted from the tissues of basidiocarp at the rate of 73 of 80 fungi collected produced single bands with a 1,100 bps length. The DNA fragment synthesized with the genomic DNA that extracted from eight ECM tips of Pinus densiflora was confirmed and analysized to the rDNAs of ECM in full sequences, and informed to be a ECM fungal species in the forest.

Development of an In Planta Molecular Marker for the Detection of Chinese Cabbage (Brassica campestris ssp. pekinensis) Club Root Pathogen Plasmodiophora brassicae

  • Kim, Hee-Jong;Lee, Youn-Su
    • Journal of Microbiology
    • /
    • 제39권1호
    • /
    • pp.56-61
    • /
    • 2001
  • Plasmodiophora brassicae is an obligate parasite, a causal organism of clubroot disease in crucifers that can survive in the soil as resting spores for many years. P. brassicae causes great losses in susceptible varieties of crucifers throughout the world. In this present study, an in planta molecular marker for the detection of P. bassicae was developed using an oligonucleotide primer set foam the small subunit gene (18S like) and internal transcribed spacer (ITS) region of rDNA. The specific primer sequences determined were TCAGCTTGAATGCTAATGTG (ITS5) and CTACCTCATTTGAGATCCTTTGA (PB-2). This primer set was used to specifically detect p. bassicae in planta. The amplicon using the specific primer set was about 1,000 bp. However, the test plant and other soil-borne fungi including Fusarium spp. and Rhizoctonia app., as well as bacteria such as Pseudomonas app. and Erwinia sup. did not show any reaction with the primer set.

  • PDF

Development of Specific Primer for Tricholoma matsutake

  • Kim, Jang-Han;Han, Yeong-Hwan
    • Mycobiology
    • /
    • 제37권4호
    • /
    • pp.317-319
    • /
    • 2009
  • In this study, in an effort to develop a method for the molecular detection of Tricholoma matsutake in Korea from other closely related Tricholomataceae, a species-specific PCR primer pair, TmF and TmR, was designed using nuclear ribosomal intertranscribed spacer (ITS) sequences. The DTmF and DTmR sequences were 5'-CCTGACGCCAATCTTTTCA-3' and 5'- GGAGAGCAGACTTGTGAGCA-3', respectively. The PCR primers reliably amplified only the ITS sequences of T. matsutake, and not those of other species used in this study.

Detection of Rhizina undulata in Soil by Nested-PCR Using rDNA ITS-specific Primer

  • Lee, Sun Keun;Lee, Jong Kyu;Lee, Seung Kyu;Kim, Kyung Hee;Lee, Sang Yong
    • 한국산림과학회지
    • /
    • 제96권5호
    • /
    • pp.585-590
    • /
    • 2007
  • Rhizina undulata is the fungus, which causes Rhizina root rot on coniferous trees. Nested-PCR using ITS-specific primer was applied to detect R. undulata from the soils of Japanese black pine (Pinus thunbergil) forests infested with the disease in Seocheon, Chungnam Province, South Korea. Soil samples were collected from four different sites, both dead trees and fruit bodies of R. undulata were present, dead trees only present, fruit bodies only present, and both were absent. Nested-PCR products specific to R. undulata ITS-region were amplified. Positive reactions were found in some samples from the sites, where dead trees and fruit bodies of R. undulata were absent as well as where both of those were present. R. undulata was mainly detected in the soil samples from the depth of 5~20 cm under the soil surface. These results show that the nested-PCR could be used to diagnose the presence or potential infestation of R. undulata in the soils of pine forests.

Detection of Genus Phytophthora and Phytophthora cryptogea-P. drechsleri Complex Group Using Polymerase Chain Reaction with Specific Primers

  • Hong, Seung-Beom;Park, In-Cheol;Go, Seung-Joo;Ryu, Jin-Chang
    • The Plant Pathology Journal
    • /
    • 제15권5호
    • /
    • pp.287-294
    • /
    • 1999
  • A technique based on the polymerase chain reaction (PCR) for the specific detection of genus Phytophthora and Phytophthora cryptogea-P. drechsleri complex group was developed using nucleotide sequence information of ribosomal DNA (rDNA) regions. The internal transcribed spacers (ITS) including 5.8S were sequenced for P. cryptogea-P. drechsleri complex group and its related species. Two pairs of oligonucleotide primers were designed. Primer pair ITS1/Phy amplified ca. 240 bp fragment in 12 out of 13 specie of Phytophthora, but not in Pythium spp., Fusarium spp.and Rhizoctonia solani. Primer pair rPhy/Pcd amplified 549 bp fragment only in P. cryptogea-P. drechsleri complex group, but not in other Phytophthora spp.and other genera. Specific PCR amplification using the primers was successful in detecting Phytophthora and P. cryptogea-P. drechsleri complex group in diseased plants.

  • PDF

Detection of Escherichia coli O157:H7, Salmonella spp., Staphylococcus aureus and Listeria monocytogenes in Kimchi by Multiplex Polymerase Chain Reaction (mPCR)

  • Park, Yeon-Sun;Lee, Sang-Rok;Kim, Young-Gon
    • Journal of Microbiology
    • /
    • 제44권1호
    • /
    • pp.92-97
    • /
    • 2006
  • We developed an mPCR assay for the simultaneous detection, in one tube, of Escherichia coli O157:H7, Salmonella spp., Staphylococcus aureus and Listeria monocytogenes using species-specific primers. The mPCR employed the E. coli O157:H7 specific primer Stx2A, Salmonella spp. specific primer Its, S. aureus specific primer Cap8A-B and L. monocytogenes specific primer Hly. Amplification with these primers produced products of 553, 312, 405 and 210 bp, respectively. All PCR products were easily detected by agarose gel electrophoresis, and the sequences of the specific amplicons assessed. Potential pathogenic bacteria, in laboratory-prepared and four commercially available kimchi products, were using this mPCR assay, and the amplicons cloned and sequenced. The results correlated exactly with sequences derived for amplicons obtained during preliminry tests with known organisms. The sensitivity of the assay was determined for the purified pathogen DNAs from four strains. The mPCR detected pathogen DNA at concentrations ranging from approximately 0.45 to $0.05\;pM/{\mu}l$. Thus, this mPCR assay may allow for the rapid, reliable and cost-effective identification of four potentially pathogens present in the mixed bacterial communities of commercially available kimchi.

Non-Invasive Sex Determination of Asiatic Black Bear (Ursus thibetanus) via Sex-Specific Amplification of the Amelogenin Gene

  • Baek-Jun Kim
    • Proceedings of the National Institute of Ecology of the Republic of Korea
    • /
    • 제4권4호
    • /
    • pp.154-158
    • /
    • 2023
  • The Asiatic black bear, Ursus thibetanus, is among the most threatened or endangered species in Asia. For its conservation and management, sex identification of U. thibetanus using non-invasive samples (e.g., hair and/or feces) is potentially valuable. In this study, a non-invasive molecular method for sex identification of U. thibetanus samples collected from various countries was first utilized, and it was based on polymerase chain reaction (PCR) amplification of the amelogenin gene via PCRs. Thirty-three bear DNA samples, extracted not only from blood (n=9) but also from hair (n=18) and feces (n=6), were used. We performed sex-specific PCR amplifications of the amelogenin gene using a primer set, SE47 and SE48. The primer set could successfully amplify a single X-specific band for females and both X- and Y-specific bands for males from all blood (100%) and hair (100%) samples. In addition, the primer set could distinguish the sex of bears in four out of a total of six fecal samples (approximately 67%). This study's findings suggest that this molecular method can be applied to sex identification of Asiatic black bears from various Asian regions using non-invasive samples, such as hair and feces.

Nested PCR 기법을 이용한 인삼 뿌리썩음병원균의 특이적 검출 (Specific Detection of Root Rot Pathogen, Cylindrocarpon destructans, Using Nested PCR from Ginseng Seedlings)

  • 장창순;이정주;김선익;송정영;유성준;김홍기
    • 식물병연구
    • /
    • 제11권1호
    • /
    • pp.48-55
    • /
    • 2005
  • Cylindrocarpon destructans는 인삼 및 수목에 뿌리썩음병을 일으키는 토양 전염병 식물병원균이다. 신속 정확한 검출 가능성을 알아보기 위하여 종 특이적인 primer와 nested PCR 기법을 활용하여 인삼 유묘로부터 뿌리썩음 병균 C. destructans로 2차 PCR증폭을 실시한 결과 병원성이 확인된 C.destructans에서만 400bp의 종특이적 증폭산물을 얻을 수 있었다. 종 특이성 primer 와 nested PCR 기법을 이용한 인삼뿌리썩음병균 DNA에 대한 반응 민감도는 최저 약 1fg으로 나타나 단 몇 개의 포자만 존재해도 검출이 가능하였다. 또한, nested PCR 기법은 실제 이병토양에 심었을 경우에도 C.destructans 에 감염된 인삼 유묘로부터만 정확하게 병원균을 검출해 내었다. 종특이적 primer 와 nested PCR 기법을 이용한 본 연구 결과는 실제 재배농가에서 인삼 경작시 뿌리썩음병 진단에 매우 유용하게 활용될 수 있을 것으로 판단된다.