• Research in Plant Disease
• /
• v.20 no.1
• /
• pp.21-24
• /
• 2014

Clubroot caused by the obligate biotrophic protist Plasmodiophora brassicae Woronin is one of the most damaging diseases of Brassicaceae family. In this study, we developed species-specific primer sets for rapid and accurate detection of P. brassicae. The primer sets developed amplified a specific fragment only from P. brassicae DNA while they did not amplify a band from 10 other soilborne pathogens or from Kimchi cabbage. In sensitivity test, the species-specific primer set ITS1-1/ITS1-2 could work for approximately 10 spores/ml of genomic DNA showing more sensitivity and accuracy than previous methods. With quantitative real-time PCR test, the primer set detected less spores of P. brassicae than before, confirming that the species-specific primer set could be useful for rapid and accurate detection of P. brassicae.

• The Korean Journal of Mycology
• /
• v.27 no.5 s.92
• /
• pp.337-340
• /
• 1999

The context and upper surface of Phellinus basidiocarp become blackened, rimose and woody. The basidiocarp is sessile, dimidiate and elongate. The basidiospores are pigmented and ovoid to globose. Hymenial setae are $17{\sim}35{\times}6{\sim}8{\mu}m$. Nineteen isolates of Phellinus species, including Phellinus linteus, were used for sequencing of the internal transcribed spacer (ITS) region of the nuclear rDNA. Based on these sequence data, specific primers were designed for identification of Phellinus linteus isolates in Korea. The specific primers were within the ITS1 and ITS2 regions and were nested within the universal primers flanking the spacer regions. A total of four primers (the universal primers ITS-1F and ITS-4, and the specific primers PL-F and PL-R) were used for detection of Phellinus linteus collected in Korea. The length of the four amplification products of Phellinus linteus DNA were 800 bp (ITS-1F/ITS-4), two bands of about 720 bp (ITS-1F/PL-R and PL-F/ITS-4), and 610 bp (PL-F/PL-R). Among 23 isolates of Phellinus species collected in Korea, Thirteen isolates were identified as Phellinus linteus based on the presence of the four bands. The other species produced only the single ITS-1F/ITS-4 product.

• Mycobiology
• /
• v.31 no.1
• /
• pp.23-31
• /
• 2003

With universal primer ITS1-F, the specific DHJ2 primer was developed to detect the Ectomycorrhizal(ECM) root tips in soil and to identify the species of ECM fungi, as based on DNA sequences of rDNA stored in GeneBank of NCBI. This primer was designed with the common sites of rDNA of Amanita and Boletus, and was also designed with several DNA programs provided by NCBI. The DNA fragments synthesized by PCR were calculated to be 1,000 to 1,200 bps of DNA located to 18s to 28s rDNA to contain two variable sites of ITS, indicating much diversities for specific species or ecotypes of ECM fungi. The primer DHJ2 reacted with the genomic DNA's extracted from the tissues of basidiocarp at the rate of 73 of 80 fungi collected produced single bands with a 1,100 bps length. The DNA fragment synthesized with the genomic DNA that extracted from eight ECM tips of Pinus densiflora was confirmed and analysized to the rDNAs of ECM in full sequences, and informed to be a ECM fungal species in the forest.

• Journal of Microbiology
• /
• v.39 no.1
• /
• pp.56-61
• /
• 2001

Plasmodiophora brassicae is an obligate parasite, a causal organism of clubroot disease in crucifers that can survive in the soil as resting spores for many years. P. brassicae causes great losses in susceptible varieties of crucifers throughout the world. In this present study, an in planta molecular marker for the detection of P. bassicae was developed using an oligonucleotide primer set foam the small subunit gene (18S like) and internal transcribed spacer (ITS) region of rDNA. The specific primer sequences determined were TCAGCTTGAATGCTAATGTG (ITS5) and CTACCTCATTTGAGATCCTTTGA (PB-2). This primer set was used to specifically detect p. bassicae in planta. The amplicon using the specific primer set was about 1,000 bp. However, the test plant and other soil-borne fungi including Fusarium spp. and Rhizoctonia app., as well as bacteria such as Pseudomonas app. and Erwinia sup. did not show any reaction with the primer set.

• Mycobiology
• /
• v.37 no.4
• /
• pp.317-319
• /
• 2009

In this study, in an effort to develop a method for the molecular detection of Tricholoma matsutake in Korea from other closely related Tricholomataceae, a species-specific PCR primer pair, TmF and TmR, was designed using nuclear ribosomal intertranscribed spacer (ITS) sequences. The DTmF and DTmR sequences were 5'-CCTGACGCCAATCTTTTCA-3' and 5'- GGAGAGCAGACTTGTGAGCA-3', respectively. The PCR primers reliably amplified only the ITS sequences of T. matsutake, and not those of other species used in this study.

• Journal of Korean Society of Forest Science
• /
• v.96 no.5
• /
• pp.585-590
• /
• 2007

Rhizina undulata is the fungus, which causes Rhizina root rot on coniferous trees. Nested-PCR using ITS-specific primer was applied to detect R. undulata from the soils of Japanese black pine (Pinus thunbergil) forests infested with the disease in Seocheon, Chungnam Province, South Korea. Soil samples were collected from four different sites, both dead trees and fruit bodies of R. undulata were present, dead trees only present, fruit bodies only present, and both were absent. Nested-PCR products specific to R. undulata ITS-region were amplified. Positive reactions were found in some samples from the sites, where dead trees and fruit bodies of R. undulata were absent as well as where both of those were present. R. undulata was mainly detected in the soil samples from the depth of 5~20 cm under the soil surface. These results show that the nested-PCR could be used to diagnose the presence or potential infestation of R. undulata in the soils of pine forests.

• The Plant Pathology Journal
• /
• v.15 no.5
• /
• pp.287-294
• /
• 1999

A technique based on the polymerase chain reaction (PCR) for the specific detection of genus Phytophthora and Phytophthora cryptogea-P. drechsleri complex group was developed using nucleotide sequence information of ribosomal DNA (rDNA) regions. The internal transcribed spacers (ITS) including 5.8S were sequenced for P. cryptogea-P. drechsleri complex group and its related species. Two pairs of oligonucleotide primers were designed. Primer pair ITS1/Phy amplified ca. 240 bp fragment in 12 out of 13 specie of Phytophthora, but not in Pythium spp., Fusarium spp.and Rhizoctonia solani. Primer pair rPhy/Pcd amplified 549 bp fragment only in P. cryptogea-P. drechsleri complex group, but not in other Phytophthora spp.and other genera. Specific PCR amplification using the primers was successful in detecting Phytophthora and P. cryptogea-P. drechsleri complex group in diseased plants.

• Journal of Microbiology
• /
• v.44 no.1
• /
• pp.92-97
• /
• 2006

We developed an mPCR assay for the simultaneous detection, in one tube, of Escherichia coli O157:H7, Salmonella spp., Staphylococcus aureus and Listeria monocytogenes using species-specific primers. The mPCR employed the E. coli O157:H7 specific primer Stx2A, Salmonella spp. specific primer Its, S. aureus specific primer Cap8A-B and L. monocytogenes specific primer Hly. Amplification with these primers produced products of 553, 312, 405 and 210 bp, respectively. All PCR products were easily detected by agarose gel electrophoresis, and the sequences of the specific amplicons assessed. Potential pathogenic bacteria, in laboratory-prepared and four commercially available kimchi products, were using this mPCR assay, and the amplicons cloned and sequenced. The results correlated exactly with sequences derived for amplicons obtained during preliminry tests with known organisms. The sensitivity of the assay was determined for the purified pathogen DNAs from four strains. The mPCR detected pathogen DNA at concentrations ranging from approximately 0.45 to $0.05\;pM/{\mu}l$. Thus, this mPCR assay may allow for the rapid, reliable and cost-effective identification of four potentially pathogens present in the mixed bacterial communities of commercially available kimchi.

• Proceedings of the National Institute of Ecology of the Republic of Korea
• /
• v.4 no.4
• /
• pp.154-158
• /
• 2023

The Asiatic black bear, Ursus thibetanus, is among the most threatened or endangered species in Asia. For its conservation and management, sex identification of U. thibetanus using non-invasive samples (e.g., hair and/or feces) is potentially valuable. In this study, a non-invasive molecular method for sex identification of U. thibetanus samples collected from various countries was first utilized, and it was based on polymerase chain reaction (PCR) amplification of the amelogenin gene via PCRs. Thirty-three bear DNA samples, extracted not only from blood (n=9) but also from hair (n=18) and feces (n=6), were used. We performed sex-specific PCR amplifications of the amelogenin gene using a primer set, SE47 and SE48. The primer set could successfully amplify a single X-specific band for females and both X- and Y-specific bands for males from all blood (100%) and hair (100%) samples. In addition, the primer set could distinguish the sex of bears in four out of a total of six fecal samples (approximately 67%). This study's findings suggest that this molecular method can be applied to sex identification of Asiatic black bears from various Asian regions using non-invasive samples, such as hair and feces.

• Research in Plant Disease
• /
• v.11 no.1
• /
• pp.48-55
• /
• 2005

Cylindrocarpon destructans is a soil-borne plant pathogenic fungus causing root rot on ginseng and trees. Rapid and exact detection of this pathogen was practiced on ginseng seedlings by nested PCR using speciesspecific primer set. The second round of PCR amplification by Dest 1 and Dest 4 primer set formed 400 bp of species-specific fragment of C. destructans from the product of first round of amplification by ITS 1 and ITS 4 primer set. In the PCR sensitivity test based on DNA density, nested PCR detected to the limit of one fg and it meant the nested PCR could detect up to a few spores of C. destructans. Also, nested PCR made it possible to detect the pathogen from ginseng seedlings infected by replantation on artificial infested soil. Our nested PCR results using species-specific primer set could be utilized for diagnosis of root rot disease in ginseng cultivation.