• 한국자원식물학회지
• /
• 제22권3호
• /
• pp.227-235
• /
• 2009

Single seeds of common buckwheat cultivar Suwon No. 1 when subjected to SDS-PAGE revealed very high polymorphism. High variation existed for protein or protein subunits with molecular weight 54-47kDa, 45-25kDa and 16-11kDa. The electrophoregram showed variation for globulin as well as other protein fractions. About 300 proteins were separated by two-dimensional electrophoresis in common buckwheat (Fagopyrum esculentum Moench.) seed. Seed maturation is a dynamic and temporally regulated phase of seed development that determines the composition of storage proteins reserves in mature seeds. Buckwheat seeds from 5, 10, 15, 20, and 25 days after pollination and matured stage were used for the analysis. This led to the establishment of high-resolution proteome reference maps, expression profiles of 48 spots. It was identified 48 proteins from MALDI-TOF/MS analysis of wild buckwheat seed storage proteins. The 48 proteins were found identical or similar to those of proteins reported in buckwheat and other plants; it is belonging to 9 major functional categories including seed storage proteins, stress/defense response, protein synthesis, photosynthesis, allergy proteins, amino acid, enzyme, metabolism, and miscellaneous. It appears that the major allergenic storage protein separated played the important role in buckwheat breeding and biochemical characterization.

• Journal of Plant Biology
• /
• 제35권2호
• /
• pp.155-163
• /
• 1992

식물세포에 tumor를 유발하는 Agrobacterium tumefaciens pTiA6 plasmid에서 virE 유전자의 발현조절기작을 분자적수준에서 규명하기 위하여 virE promoter의 5＇-말단을 제거하여 얻은 truncated virE 재조합플라스미드를 이용하여 virE promoter의 조절부위에 대하여 연구하였다. virE promoter의 기능이 존재하는 truncated virE 재조합플라스미드인 pJS201은 전기영동에 의하여 virE promoter의 5＇-말단으로부터 약 130개의 염기가 제거된 것으로 측정되었다. 한편 virE promoter의 기능을 상실한 pJS301에서 dideoxy chain termination방법으로 truncated virE promoter 염기서열을 결정한 결과 263개의 염기가 제거된 것으로 확인되었다. 따라서 virE promoter의 조절부위는 virE promoter의 5＇-말단으로부터 약 130번째의 염기에서 263번째의 염기사이에 존재하는 것으로 사료되며, 이 사이에 23개의 염기로 이루어진 역반복서열(AACTTTGCGCTATAGGCAAAGTT)이 존재하고 있는데, 이 부위가 virE operon의 발현에 있어서 RNA polymerase의 최초 인식부위(recognition site)일 것으로 사료된다.

• 한국작물학회:학술대회논문집
• /
• 한국작물학회 2017년도 9th Asian Crop Science Association conference
• /
• pp.23-23
• /
• 2017

Rice (Oryza sativa L.) is the world's most important cereal crop. In crop plant, chlorophyll content and leaf senescence could affect grain filling and yield. We analyzed a QTL associated with chlorophyll content and delayed leaf senescence using high chlorophyll near isogenic line (HC-NIL). HC-NIL derived from a cross between Oryza sativa cv. Hwaseong as a recurrent parent and wild species O. grandiglumis as a donor parent showed higher chlorophyll content than Hwaseong. To identify QTL associated with chlorophyll content, 58 $F_3$ and 38 $F_4$ lines were developed from a cross between HC-NIL and Hwaseong. For QTL analysis, simple sequence repeat (SSR) markers were used for genotyping and one-way ANOVA was conducted. A QTL for chlorophyll content (qCC2) was detected in chromosome 2 and explained 24.63% of phenotypic variation. The senescence effect of the qCC2 was examined in dark-induced incubation (DII). Detached leaves from Hwaseong and HC-NIL were incubated on 3mM MES buffer (pH 5.8) at $27^{\circ}C$ under complete dark condition. After 3 days of incubation, the Hwaseong leaves turned yellow, but the HC-NIL leaves were green. HC-NIL has higher chlorophyll content with delayed senescence than Hwaseong. These results indicated that qCC2 is associated with stay-green phenotype. To know whether the qCC2 is responsible for leaf functionality, ion leakage test and Fv/Fm measurement were performed. Both experiment results showed that differences were observed between Hwaseong and HC-NIL but it was not statistically significant. These results might suggest that the qCC2 is possibly related to chlorophyll content and non-functional stay-green phenotype.

• 공업화학
• /
• 제29권4호
• /
• pp.425-431
• /
• 2018

UV 및 블루라이트를 차단하는 세륨 옥사이드 나노 입자와 다공성 실리카와의 복합입자를 건식 코팅 공정을 통해 제조하였다. 실리카와 세륨 옥사이드 간 혼합 비율과 메카노 퓨전 장치의 챔버 회전속도 등의 제조 조건을 달리하여 여러 복합입자를 만든 후, 입자 표면 형태를 SEM으로 관측 비교하고 XRF을 통해 복합입자의 조성을 분석하였다. 세륨 옥사이드를 실리카와 함께 복합입자로 만들어 물에 분산시키면 현탁 용액의 투명도가 높아지고 분산 안정성이 향상되었다. 또한 파우더의 유동성과 발림성이 개선되었다. 본 연구를 통해 세륨 옥사이드/실리카 복합입자가 자외선 및 블루라이트를 차단하는 기능성 화장품 소재로 사용 가능함을 확인하였다.

• The Plant Pathology Journal
• /
• 제21권1호
• /
• pp.47-54
• /
• 2005

Identification of host genes involved in disease progresses and/or defense responses is one of the most critical steps leading to the elucidation of disease resistance mechanisms in plants. Soybean mosaic virus (SMV) is one of the most prevalent pathogen of soybean (Glycine max). Although the soybeans are placed one of many important crops, relatively little is known about defense mechanism. In order to obtain host genes involved in SMV disease progress and host defense especially for virus resistance, two different cloning strategies (DD RT-PCR and Subtractive hybridization) were employed to identify pathogenesis- and defenserelated genes (PRs and DRs) from susceptible (Geumjeong 1) and resistant (Geumjeong 2) cultivars against SMV strain G7H. Using these approaches, we obtained 570 genes that expressed differentially during SMV infection processes. Based upon sequence analyses, differentially expressed host genes were classified into five groups, i.e. metabolism, genetic information processing, environmental information processing, cellular processes and unclassified group. A total of 11 differentially expressed genes including protein kinase, transcription factor, other potential signaling components and resistant-like gene involved in host defense response were selected to further characterize and determine expression profiles of each selected gene. Functional characterization of these genes will likely facilitate the elucidation of defense signal transduction and biological function in SMV-infected soybean plants.

• 신재생에너지
• /
• 제9권2호
• /
• pp.30-39
• /
• 2013

Multi-crystalline silicon solar cells is not exist a specific crystal direction different from single crystalline silicon solar cells. In functional materials, therefore, isotropic wet etching of mc-Si solar cell is easy the acid solution rather than the alkaline solution. The reflectance of wet texturing process is about 25% and the reflectance of RIE texturing process is achieved less than 10%. In addition, wet texturing has many disadvantages as well as reflectance. So wet texturing process has been replaced by a RIE texturing process. In order to apply BIPV, RIE and wet textured multi-crystalline silicon solar cell modules was manufactured by different kind of EVA sheet. Moreover, in case of BIPV, the short circuit current characteristics according to the angle of incidence is more important, because the installation of BIPV is fixed location. In this study, we has measured SEM image and I-V curve of RIE and wet textured silicon solar cell and PV module. Also we has analyzed quantum efficiency characteristics of RIE and wet textured silicon solar cell for PV modules depending on incidence angle.

• 한국식물생명공학회:학술대회논문집
• /
• 한국식물생명공학회 2002년도 춘계학술대회
• /
• pp.41-47
• /
• 2002

Adverse environmental conditions such as drought, high salt and cold/freezing are major factors that reduces crop productivity worldwide. According to a survey, 50-80% of the maximum potential yield is lost by these 'environmental or abiotic stresses', which is approximately ten times higher than the loss by biotic stresses. Thus, improving stress-tolerance of crop plants is an important way to improve agricultural productivity. In order to develop such stress-tolerant crop plants, we set out to identify key stress signaling components that can be used to develop commercially viable crop varieties with enhanced stress tolerance. Our primary focus so far has been on the identification of transcription factors that regulate stress responsive gene expression, especially those involved in ABA-mediated stress response. Be sessile, plants have the unique capability to adapt themselves to the abiotic stresses. This adaptive capability is largely dependent on the plant hormone abscisic acid (ABA), whose level increases under various stress conditions, triggering adaptive response. Central to the response is ABA-regulated gene expression, which ultimately leads to physiological changes at the whole plant level. Thus, once identified, it would be possible to enhance stress tolerance of crop plants by manipulating the expression of the factors that mediate ABA-dependent stress response. Here, we present our work on the isolation and functional characterization of the transcription factors.

• 상하수도학회지
• /
• 제24권4호
• /
• pp.453-462
• /
• 2010

Nowadays, the challenges of ensuring good water quality and quantity of river are becoming more important for human society, but there has been troublesome for purifying river water. In this study, we performed the fundamental study of a river water treatment system using riverside soil and eco-friendly optimal media for improving river water quality and can also treat a large amount of river water. As the results of the physical and chemical characterization of the two different soils (Kyungan and Chungrang, The Republic of Korea), which were collected from real stream sides in the Han River basin, and five kinds of media (zeolite, perlite, steel slag, woodchip and mulch), both soils were all classified as a sand, and effective size ($D_{10}$) and uniformity coefficient (U) of the soil were about 0.2 mm and 4 or so, respectively. Through the batch and column experiments with the soil and eco-friendly media, zeolite and mulch were found to be efficient for decreasing nitrogen. In addition, steel slag was especially superior to the other media for phosphorus removal. From soil reforming tests volume ratios were 2.8, 1, and 1 of Kyungan soil, zeolite, and steel slag hydraulic conductivity of mixed soil was increased $1.30{\times}10^{-2}$ from $2.85{\times}10^{-3}$ of Kyungan soil, and the removal efficiencies of nitrogen and phosphorus were also improved. These results show that reforming of the soil enhanced the purification of a large amount of water, and zeolite, mulch, and steel slag might be facilitated as proper functional media.

• 한국축산식품학회지
• /
• 제40권2호
• /
• pp.209-220
• /
• 2020

Milk fat globule membrane (MFGM) is a lipid carrier in mammals including humans that consists mainly of polar lipids, like phospholipids and glycolipids. In this study, a process to enrich polar lipids in commercial butter and whey powder, including polar lipids of MFGM, was developed. WPC (whey protein concentrate) 60 was selected as the most suitable raw material based on the yield, phospholipid, protein, and lactose content of the polar lipid fraction obtained by ethanol extraction of two WPC (WPC60 and WPC70) and two buttermilk (A and B). After fractionation under optimum conditions, the polar-lipid enriched fraction from WPC60 contained 38.56% phospholipids. The content of glycolipids, cerebroside, lactosylceramide, ganglioside GM3, ganglioside GD3, was 0.97%, 0.55%, 0.09%, and 0.14%, respectively. Rancimat results showed that the oxidation stability of fish oil increased with an increase in the polar-lipid fraction by more than 30 times. In addition, the secretion of IL-6 and TNF-α decreased in a concentration-dependent manner after treatment of RAW 264.7 cells with 0.1 to 100 ppm of the polar lipid fraction. In this study, polar lipid concentrates with antioxidant and anti-inflammatory activity, were prepared from milk processing by-products. The MFGM polar lipid concentrates made from by-products are not only additives for infants, but are also likely to be used as antioxidants in cooking oils and as active ingredients for functional foods.

• 한국세라믹학회지
• /
• 제42권10호
• /
• pp.665-671
• /
• 2005

LSGM is known to show very serious interfacial reaction with other unit cell components, such as electrode, electrode functional or buffering layers. Especially, the formation of very resistive LaSr$Ga_{3}$$O_{7}$ phase at the interface of an anode and an electrolyte is the most problematic one in LSGM-based SOFCs. In this study, we investigated the interfacial reactions in LSGM-based SOFCs under different unit cell configurations. According to the microstructural analysis on the interfacial layer between an electrolyte and its neighboring component, serious interfacial reaction zone was observed. From the electrical and electrochemical characterization of the cell, we found such an interfacial reaction zone not only increased the internal ohmic resistance but also decreased the OCV(Open Cell Voltage) of the unit cell, and thus consequently deteriorated the unit cell performance.