• Korean Journal of Microbiology
• /
• v.24 no.3
• /
• pp.204-210
• /
• 1986

One clone(pANt32) carring tRNA/sup Arg/ gene was selected from Aspergillus total tRNA gene clones. The nucleotide sequences of this tRNA gene were determined by Maxam and Gilbert's chemical cleavage methods. The sequence of this tRNA gene is as follow; 5'GGCCGGCTGCCCAATTGGCAAGGCGTCTGACTACGAATCAGGAGAT TGCAGGTTCGAGCCCTGCGTGGGTCA3'. This sequence conicides with the characteristecs of other eukaryotic tRNA. Some consensus sequences (ACT-TA bow, TATTTT and T-cluster) are found in both 5'-end and 3'-end flanking regions.

• Korean Journal of Microbiology
• /
• v.28 no.1
• /
• pp.1-5
• /
• 1990

The coding sequence of hepatitis B viral core antigen (HBcAg) (subtype adr) contains two in-phase initiation codons, one for precore and the other for core antigen gene. To study the expression of core antigen and the role of precore region, the coding sequence of HBcAg with or without precore (pre-C) region were subcloned into yeast expression vector containing phosphoglycerate kinase (PGK) promoter. To study the role of upstream region in the expression of the core antigen, a series of 5' deletion mutants were also subcloned into the vector. After transformation into various host strains, the expression of HBcAg were analysed by radio-immunoassat. Under optimal condition of core antigen gene expression in yeast, the highest amount of antigen was detected in the cell line SHY4 containing pGKHBc plasmid composed of the yeast PGK gene promoter, terminator and C-gene. Regardless of the presence of precore region, core antigen was not detected in the medium but in cell extract. These results suggest that precore region cannot affect the secretion of core antigen in Saccharomyces cerevisiae.

• Nutrition Research and Practice
• /
• v.14 no.5
• /
• pp.478-489
• /
• 2020

BACKGROUND/OBJECTIVES: Morusin, a marker component of Morus alba L., possesses anti-cancer activity. The objective of this study was to determine autophagy-inducing effect of morusin in non-small cell lung cancer (NSCLC) cells and investigate the underlying mechanism. SUBJECTS/METHODS: Autophagy induction and the expression of autophagy-related proteins were analyzed by LC3 immunofluorescence and western blot, respectively. The role of autophagy and AMP-activated protein kinase (AMPK) was determined by treating NSCLC cells with bafilomycin A1, an autophagy inhibitor, and compound C, an AMPK inhibitor. Cytotoxicity and apoptosis induction were determined by MTT assay, trypan blue exclusion assay, annexin V-propidium iodide (PI) double staining assay, and cell cycle analysis. RESULTS: Morusin increased the formation of LC3 puncta in the cytoplasm and upregulated the expression of autophagy-related 5 (Atg5), Atg12, beclin-1, and LC3II in NSCLC cells, demonstrating that morusin could induce autophagy. Treatment with bafilomycin A1 markedly reduced cell viability but increased proportions of sub-G1 phase cells and annexin V-positive cells in H460 cells. These results indicate that morusin can trigger autophagy in NSCLC cells as a defense mechanism against morusin-induced apoptosis. Furthermore, we found that AMPK and its downstream acetyl-CoA carboxylase (ACC) were phosphorylated, while mammalian target of rapamycin (mTOR) and its downstream p70S6 kinase (p70S6K) were dephosphorylated by morusin. Morusin-induced apoptosis was significantly increased by treatment with compound C in H460 cells. These results suggest that morusin-induced AMPK activation could protect NSCLC cells from apoptosis probably by inducing autophagy. CONCLUSIONS: Our findings suggest that combination treatment with morusin and autophagy inhibitor or AMPK inhibitor might enhance the clinical efficacy of morusin for NSCLC.

• Korean Journal of Microbiology
• /
• v.36 no.1
• /
• pp.46-51
• /
• 2000

Salmonella typhi is one of important causes of human enteric infections. S. typhi KNIH100 was isolated from a patient of typhoid fever in Korea. We cloned a 5.0 kb SalⅠ fragment containing the aroA gene encoding a 5-enolpyruvylshikimate-3-phosphate synthetase from chromosomal DNA of this strain. This recombinant plasmid was named pSAL80. E. coli CGSC2829, an aroA- mutant, was not grown on the M9 minimal medium but E. coli CGSC2829 (pSAL80) was grown on the M9 minimal medium. The aroA gene was composed of 1,284 base pairs with ATG initiation codon and TAA termination codon. Sequence comparison of the aroA gene exhibited 99%, 98%, and 77% identity with those of S. typhi Ty2, S. typhimurium, and E. coli respectively. As in the cases of Shigella sonnei and E. coli, the serC and aroA genes lie in a single operonic structure.

• Korean Journal of Plant Resources
• /
• v.24 no.5
• /
• pp.584-590
• /
• 2011

Wound inducible P450-Esg cDNA, one of cytochrome P450 gene family, was isolated from shoot of Euiseong garlic cultivar. P450-Esg cDNA possesses highly conserved heme-binding domain in the nucleotide sequence, and 1,419 bp of open reading frame (ORF) coding of 473 amino acids. Based on the nucleotide sequence analysis of P450-Esg homologous from twelve garlic cultivars, two domains, one domain between 472 to 510 bp, and the other between 1,210 to 1,249 bp from start codon (ATG), showed various nucleotide polymorphism among cultivars. Sequence of heme-binding domain in P450-Esg homologous, which is located at the domain between 1,210 to 1,240 bp from start codon, showed various nucleotide polymorphism as well as amino acid sequence polymorphism among twelve garlic cultivars. Anther domain, between 472 to 510 bp from start codon, showed exactly same amino acid sequence in the twelve garlic cultivars, but there were various single nucleotide polymorphism to the cultivars.

• Korean Journal of Microbiology
• /
• v.42 no.1
• /
• pp.67-72
• /
• 2006

The nucleotide sequence of the cloned cellulolytic xylanase gene (bglBC2) from B. circulans ATCC21367 was determined. bglBC2 consists of an 1,224 bp open reading frame (ORF) coding for a polypeptide of 407 amino acids with a deduced molecular weight of 45 kDa. The Shine-Dalgarno (SD) sequence (5'-AAAGGAG-3') was found 9 bp upstream of the initiation codon, ATG. A promoter region corresponding closely to the B. subtilis consensus sequence (-35: TTGACA,-10: TATAAT) was detected, the putative -35 and -10 sequences of which were TTTACA and TATACT, respectively. The deduced amino acid sequence of the cellulolytic xylanase showed 97% homology with that of the alkaline $endo-\beta-1,4-glucanase$ from B. circulans KSM-N257, 75% homology with that of the $endo-\beta-1,3-1,4-glucanase$ from B. circulans WL-12, and 45% homology with that of the $endo-\beta-1,4-glucanase$ (cellulase) from Bacillus sp. KSM-330. The bglBC2 sequence was deposited in Gen-Bank under the accession number AY269256.

• International Journal of Oral Biology
• /
• v.41 no.1
• /
• pp.45-51
• /
• 2016

Rutin (3,3',4',5,7-pentahydroxyflavone-3-rhamnoglucoside) is a bioactive flavonoid from the plant kingdom. Rutin has been studied as potential anticancer agent due to its wide range of pharmacological properties including antioxidative, anti-inflammatory and anticancer. Autophagy is a conserved intracellular catabolic pathway to maintain cell homeostasis by formation of autophagosome. Processing of autophagy involves various molecules including ULK1 protein kinase complex, Beclin-1-Vps34 lipid kinase complex, ATG5, ATG12, and LC3 (light chain 3). Cargo-carried autophagosomes fuse with lysosomes resulting in autophagolysosome to eliminate vesicles and degrade cargo. However, the actions of rutin on autophagy are not clearly understood. In this study, we analyzed the effect of rutin on autophagy and inflammation in cancer cell lines. Interestingly, rutin induced autophagy in leukemia (THP-1), oral (CA9-22), and lung (A549) cell lines. TNF-${\alpha}$, key modulator of inflammation, was upregulated by inhibition of rutin-induced autophagy. Taken together, these data indicated that rutin induced autophagy and consequently suppressed TNF-${\alpha}$ production.

• Reproductive and Developmental Biology
• /
• v.37 no.2
• /
• pp.65-73
• /
• 2013

The objective of this study was to examine the effects of high concentrations of glucose on porcine parthenotes developing in vitro. Addition of 55 mM glucose to the culture medium of embryos at the four-cell-stage significantly inhibited blastocyst formation, resulting in fewer cells in blastocyst-stage embryos and increased levels of apoptosis and autophagy compared to control. Quantitative reverse transcriptase (RT) PCR analysis revealed that the expression of pro-apoptotic genes (Caspase 3, Bax and Bak) and autophagy genes (Atg6 and Atg8/Lc3) were increased significantly by the addition of 55 mM glucose to the culture medium compared to control. MitoTracker Green fluorescence revealed a decrease in the overall mitochondrial mass compared to control. However, the addition of 55 mM glucose had no effect on mRNA expression of the nuclear DNA-encoded mitochondrial-related genes, cytochrome oxidase (Cox) 5a, Cox5b and Cox6b1. These results suggest that hyperglycemia reduced the mitochondrial content of porcine embryos developing in vitro and that this may hinder embryonic development to the blastocyst stage and embryo quality by increasing apoptosis and autophagy in these embryos.

• Korean Journal of Microbiology
• /
• v.39 no.3
• /
• pp.123-127
• /
• 2003

Sphingomonas chungbukensis DJ77 is able to metabolize phenanthrene as the sole carbon and energy source. The plasmid pUPX5 includes phnS gene encoding 2-hydroxychromene-2-carboxylate (HCCA) isomerase, which is needed for phenanthrene and naphthanene degradation. We determined the nucleotide sequence of DNA fragment of 3271 bp which included the phnS gene. The fragment included an open reading frame of 594 bp which has ATG initiation codon and TAA termination codon and GGAA ribosomal binding site. The predicted amino acid sequence of the enzyme consists of 198 amino acids. The deduced amino acid sequence of the phnS enzyme exhibited 94％ identity with that of the corresponding enzyme in Sphingomonas aromaticivorans F199. The phnS gene is located downstream and in the same operon as phnQ and phnR, encoding a 2,3-dihydroxybiphenyl 1,2-dioxygenase and a ferredoxin component of biphenyl dioxygenase, respectively.

• Korean Journal of Plant Tissue Culture
• /
• v.26 no.2
• /
• pp.121-126
• /
• 1999

Calli were induced from the petiole explants of Pimpinella brachycarpa on MS medium supplemented with 0.5 mg/L 2,4-D and 0.1 mg/L BA after four weeks of culture. Compact clusters of small and dense cells among these calli were selected and suspension-cultured as the source of embryogenic calli. When transferred to MS medium with 0.1 mg/L NAA, the suspension-cultured cells grew to embryogenic callus. Somatic embryos derived from these embryogenic calli developed into plantlets. The cDNA library was constructed in the embryogenic callus and in order to screen the cDNA library, these cDNAs were plated at a density 1.5 $\times$ 10^5 plaques per 15 cm petridish. Among 19 clones showing preferential hybridization with petiole HD-Zip gene, five clones were obtained after second screening. Four clones among them, were highly homologous to P. brachycarpa shoot-tip Phz4 gene, but one clone, Phc5 was about 1.5 kb which has an extra 163 bp to 5' upstream of Phz4. The Phc5 was 1,531 bp containing poly A tails of 18 bases. ATG start codon for Phc5, was located at position 284 with an open reading frame of 906 by which encodes a polypeptide of 302 amino acids. The Phc5 protein revealed that the polypeptides between 135 and 195 contain a homeodomain as the `leucine zipper' motif.