• Journal of Microbiology
• /
• v.39 no.1
• /
• pp.56-61
• /
• 2001

Plasmodiophora brassicae is an obligate parasite, a causal organism of clubroot disease in crucifers that can survive in the soil as resting spores for many years. P. brassicae causes great losses in susceptible varieties of crucifers throughout the world. In this present study, an in planta molecular marker for the detection of P. bassicae was developed using an oligonucleotide primer set foam the small subunit gene (18S like) and internal transcribed spacer (ITS) region of rDNA. The specific primer sequences determined were TCAGCTTGAATGCTAATGTG (ITS5) and CTACCTCATTTGAGATCCTTTGA (PB-2). This primer set was used to specifically detect p. bassicae in planta. The amplicon using the specific primer set was about 1,000 bp. However, the test plant and other soil-borne fungi including Fusarium spp. and Rhizoctonia app., as well as bacteria such as Pseudomonas app. and Erwinia sup. did not show any reaction with the primer set.

• Journal of Information Technology Applications and Management
• /
• v.18 no.4
• /
• pp.183-202
• /
• 2011

Since smart phones are changing the media for communication and its related mobile market, it is imperative to attract more application developers for success in application store business in order to attract more app users. By using aspects of the commitment marketing theory and the relationship marketing theory, this research study identified factors that influence on the relational commitment of application developers to the market. Survey of application developers from Korean mobile application developers' community was conducted to test the hypothesized model. The empirical results showed from an economic behavioral perspective market demand for applications and perceived usefulness of development tool led to relational commitment of developers mediated by perceived satisfaction while attractiveness of alternatives had no significant effect. In addition, fairness of review process and interactivity, based on the relationship marketing theory perspective, showed significant effect on the relational commitment of developers mediated by trust for application market.

• International Journal of Contents
• /
• v.9 no.4
• /
• pp.35-44
• /
• 2013

This study tries to identify the determinants of user's attitude toward apps, intention to use and continual consuming intention. This study holds the two main constructs: (1) user's intrinsic determinants- value, innovativeness, gender, Well-being and superordinate influence - on the attitude toward mobile apps, (2) the relation between attitude and app purchase & repurchase intention, and the affecting factors among this relation. In the empirical test result, value, innovation and superordinate influence were identified to affect the attitude. All the relation among attitude, purchase and repurchase intention showed positive significant relationship. In addition, satisfaction intensified the relation between purchase and repurchase intention.

• The Journal of Information Systems
• /
• v.25 no.4
• /
• pp.163-179
• /
• 2016

Purpose This study investigates the associations between SNS fatigue and stress of smartphone SNS, with SNS characteristics. The study focuses on two types of SNS characteristics: information and systems characteristics. We examine SNS stress factors that includes the communication and system overload. Design/methodology/approach To test the proposed hypotheses, the study conducted structural equation modeling with Smart PLS 3.0. The study conducted A sample of 286 participants was collected from SNS users. Findings The results indicated that the information relevance in the information characteristics had an effect on the communication overload, but it had not an effect on the system overload. The information accuracy had an effect on the communication and system overload. The app pace of change influenced the communication and system overload, but the app complexity influenced the system overload. Finally, the SNS stress showed significant relationship with SNS fatigue. The academic and managerial implications were discussed based on the this results.

• Proceedings of the Korean Society of Computer Information Conference
• /
• 2011.01a
• /
• pp.321-322
• /
• 2011

이 논문에서는 최근 각광 받는 의료 융합 IT를 이용한 모바일 콘텐츠로써 안과 병원을 찾지 않고도 스마트폰을 이용하여 건강관리 서비스를 제공하는 스마트폰 앱의 개발을 다룬다. 개발하려는 서비스를 통하여, 자신의 눈 상태를 체크하고 예방할 수 있으며, 주기적인 시력검사 및 색맹/색약, 난시/근시 등의 질환을 검사하고 동체시력운동, 원근법 눈운동, 눈체조 등 눈이 좋아지는 운동과 눈이 좋아지는 그림을 통하여 눈의 피로를 해소하고자 한다. 또한 검사 결과에 따른 개인별 검사 관리표, 시력 예방 관리 그래프 제공하여 자가진단 및 시력 관리를 할 수 있도록 한다. 이러한 서비스는 시간과 장소에 구애 받지 않고 사용자에게 제공 하도록 스마트폰 앱으로 개발한다.

• Journal of the Korea Society of Computer and Information
• /
• v.28 no.3
• /
• pp.189-196
• /
• 2023

This paper analyzes the level of satisfaction of two groups of teachers who were educated about artificial intelligence using App Inventor. The participants were 13 pre-service and 9 in-service elementary school teachers and the data was collected using a questionnaire. As a result of the study, in-service teachers were all more satisfied than pre-service teachers in terms of interest, difficulty, and participation in the education. In addition, the questions investigating whether education helped motivate learning of artificial intelligence and whether there is a willingness to apply it to elementary classes in the future were also more positive for in-service teachers than for pre-service teachers. In general, pre-service teachers had somewhat more negative views than in-service teachers, but they were more positive than in-service teachers in terms of whether the education helped improve their understanding of artificial intelligence and whether they were willing to participate in additional education. Analysis of the Mann-Whitney test to see if there was a significant difference in satisfaction between the two groups showed no significance. This may be because most of the students in the two groups already had block-type or text-type programming experience, so they were able to participate in the education without any special resistance or difficulty with App Inventor, resulting in high levels of satisfaction from both groups. The results of this study can provide basic data for the future development and operation of programs for artificial intelligence education for both pre-service and in-service elementary school teachers.

• Transactions of the Korean Society of Pressure Vessels and Piping
• /
• v.8 no.3
• /
• pp.1-6
• /
• 2012

The containment Integrated Leakage Rate Testing(ILRT) of nuclear power plants in Korea is performed in accordance with NSSC(Nuclear Safety and Security Commission) code 2012-16 and ANSI/ANS 56.8-1994. Nuclear power plants in Korea and the United States are to apply same test criteria, ANSI/ANS 56.8-1994, except type A testing time. NPPs in Korea apply 24 hours according to NSSC code 2012-16, but NPPs in United States apply 8 hours according to 10CFR50 App. J for type A test. So, there are many difficulties in order to perform ILRT in Korea. In this study, I review the impact on the ILRT results and the effect of ILRT due to type A testing time. The future, we will continue study to enhance the test reliability and improve these problems.

• Journal of The Korean Association of Information Education
• /
• v.21 no.4
• /
• pp.415-424
• /
• 2017

Due to the influence of the fourth industrial revolution in recent years, maker education is getting attention. Therefore, this study tried to propose the possibility of application (app) development education as maker education by empirically verifying the affective and cognitive effects of app development education using authoring tool. To do this, we implemented app development education in D high school in Seoul, Korea, and collected data from 41 participants. We analyzed the changes in attitudes toward SW education and creative problem-solving ability before and after the education by conducting the paired t-test, and the level of satisfaction and perceived achievement through descriptive statistics analysis. Also, the learner's responses collected through the open-ended questionnaire were analyzed qualitatively. The result showed that the attitude toward SW education and creative problem-solving ability showed statistically significant improvement after app development education using the authoring tool, and the learner's statement also supported this result. Also, satisfaction and perceived achievement after the education were relatively high. Through these results, we have empirically confirmed the effect of app development education using the authoring tool for high school students, and derived the theoretical and practical implications.

• Journal of Service Research and Studies
• /
• v.14 no.2
• /
• pp.101-116
• /
• 2024

As the spread of smartphones has become more common and the utilization rate has increased, the mobile shopping market is also growing and expectations for related industries are also increasing. Mobile shopping apps are converging with various industries such as fashion, beauty, and lifestyle, and competition among companies to increase the number of users is intensifying with the activation of non-face-to-face. Accordingly, in this study, a study on the perceived value and intention to use mobile shopping apps was conducted based on a VAM. In order to test the hypothesis of this study, a questionnaire was conducted on 266 people who had used a mobile shopping app and it was used for analysis. Looking at the results, it was confirmed that both usefulness and enjoyment among the perceived benefit of mobile shopping apps have a positive (+) effect on the perceived value. However, it was found that the technicality and perceived risk among the perceived sacrifices of mobile shopping apps did not significantly affect the perceived value. Finally, it was confirmed that the perceived value of the mobile shopping app had a positive (+) effect on the intention to use. Through this study, we would like to examine the factors that can affect perceived value and usage intention in the mobile shopping app industry, which is increasingly competitive among companies along with the rapid growth of mobile technology and market, and suggest practical implications for related companies and officials to establish efficient strategies to further increase mobile shopping app users.

• Information Systems Review
• /
• v.20 no.2
• /
• pp.21-37
• /
• 2018

Under ubiquitous work environment, innovative changes occur in work process with ICT. The work process for collaboration through mobile devices and network should be investigated. The research model consists of two major antecedents: autonomy and interdependence as a task characteristic and job satisfaction as ultimate consequence followed by work design theory. To elaborate work design theory, smartwork application (app) use, communication extent, and work-life balance were reviewed from the literature. Data were collected from three ICT firms, which adopted certain smartwork app, and a partial least squares analysis was made on 175 data points. The analysis results show that task interdependence exerts a statistically significant effect on the level of smartwork app usage. Communication extent directly affects job satisfaction and work-life balance. The remarkable point is that smartwork app usage does not affect employees' work-life balance; the former can only affect the latter indirectly by increasing communication extent. This study attempts to explain the organizational impact by considering smartwork app and the effects simultaneously. We proposed and empirically tested the extended work design theory including information technology and its environment. Based on the results, other theoretical and practical contributions are discussed at the end with limitations and further studies.