One clone(pANt32) carring tRNA/sup Arg/ gene was selected from Aspergillus total tRNA gene clones. The nucleotide sequences of this tRNA gene were determined by Maxam and Gilbert's chemical cleavage methods. The sequence of this tRNA gene is as follow; 5'GGCCGGCTGCCCAATTGGCAAGGCGTCTGACTACGAATCAGGAGAT TGCAGGTTCGAGCCCTGCGTGGGTCA3'. This sequence conicides with the characteristecs of other eukaryotic tRNA. Some consensus sequences (ACT-TA bow, TATTTT and T-cluster) are found in both 5'-end and 3'-end flanking regions.
The coding sequence of hepatitis B viral core antigen (HBcAg) (subtype adr) contains two in-phase initiation codons, one for precore and the other for core antigen gene. To study the expression of core antigen and the role of precore region, the coding sequence of HBcAg with or without precore (pre-C) region were subcloned into yeast expression vector containing phosphoglycerate kinase (PGK) promoter. To study the role of upstream region in the expression of the core antigen, a series of 5' deletion mutants were also subcloned into the vector. After transformation into various host strains, the expression of HBcAg were analysed by radio-immunoassat. Under optimal condition of core antigen gene expression in yeast, the highest amount of antigen was detected in the cell line SHY4 containing pGKHBc plasmid composed of the yeast PGK gene promoter, terminator and C-gene. Regardless of the presence of precore region, core antigen was not detected in the medium but in cell extract. These results suggest that precore region cannot affect the secretion of core antigen in Saccharomyces cerevisiae.
BACKGROUND/OBJECTIVES: Morusin, a marker component of Morus alba L., possesses anti-cancer activity. The objective of this study was to determine autophagy-inducing effect of morusin in non-small cell lung cancer (NSCLC) cells and investigate the underlying mechanism. SUBJECTS/METHODS: Autophagy induction and the expression of autophagy-related proteins were analyzed by LC3 immunofluorescence and western blot, respectively. The role of autophagy and AMP-activated protein kinase (AMPK) was determined by treating NSCLC cells with bafilomycin A1, an autophagy inhibitor, and compound C, an AMPK inhibitor. Cytotoxicity and apoptosis induction were determined by MTT assay, trypan blue exclusion assay, annexin V-propidium iodide (PI) double staining assay, and cell cycle analysis. RESULTS: Morusin increased the formation of LC3 puncta in the cytoplasm and upregulated the expression of autophagy-related 5 (Atg5), Atg12, beclin-1, and LC3II in NSCLC cells, demonstrating that morusin could induce autophagy. Treatment with bafilomycin A1 markedly reduced cell viability but increased proportions of sub-G1 phase cells and annexin V-positive cells in H460 cells. These results indicate that morusin can trigger autophagy in NSCLC cells as a defense mechanism against morusin-induced apoptosis. Furthermore, we found that AMPK and its downstream acetyl-CoA carboxylase (ACC) were phosphorylated, while mammalian target of rapamycin (mTOR) and its downstream p70S6 kinase (p70S6K) were dephosphorylated by morusin. Morusin-induced apoptosis was significantly increased by treatment with compound C in H460 cells. These results suggest that morusin-induced AMPK activation could protect NSCLC cells from apoptosis probably by inducing autophagy. CONCLUSIONS: Our findings suggest that combination treatment with morusin and autophagy inhibitor or AMPK inhibitor might enhance the clinical efficacy of morusin for NSCLC.
Salmonella typhi is one of important causes of human enteric infections. S. typhi KNIH100 was isolated from a patient of typhoid fever in Korea. We cloned a 5.0 kb SalⅠ fragment containing the aroA gene encoding a 5-enolpyruvylshikimate-3-phosphate synthetase from chromosomal DNA of this strain. This recombinant plasmid was named pSAL80. E. coli CGSC2829, an aroA- mutant, was not grown on the M9 minimal medium but E. coli CGSC2829 (pSAL80) was grown on the M9 minimal medium. The aroA gene was composed of 1,284 base pairs with ATG initiation codon and TAA termination codon. Sequence comparison of the aroA gene exhibited 99%, 98%, and 77% identity with those of S. typhi Ty2, S. typhimurium, and E. coli respectively. As in the cases of Shigella sonnei and E. coli, the serC and aroA genes lie in a single operonic structure.
Wound inducible P450-Esg cDNA, one of cytochrome P450 gene family, was isolated from shoot of Euiseong garlic cultivar. P450-Esg cDNA possesses highly conserved heme-binding domain in the nucleotide sequence, and 1,419 bp of open reading frame (ORF) coding of 473 amino acids. Based on the nucleotide sequence analysis of P450-Esg homologous from twelve garlic cultivars, two domains, one domain between 472 to 510 bp, and the other between 1,210 to 1,249 bp from start codon (ATG), showed various nucleotide polymorphism among cultivars. Sequence of heme-binding domain in P450-Esg homologous, which is located at the domain between 1,210 to 1,240 bp from start codon, showed various nucleotide polymorphism as well as amino acid sequence polymorphism among twelve garlic cultivars. Anther domain, between 472 to 510 bp from start codon, showed exactly same amino acid sequence in the twelve garlic cultivars, but there were various single nucleotide polymorphism to the cultivars.
The nucleotide sequence of the cloned cellulolytic xylanase gene (bglBC2) from B. circulans ATCC21367 was determined. bglBC2 consists of an 1,224 bp open reading frame (ORF) coding for a polypeptide of 407 amino acids with a deduced molecular weight of 45 kDa. The Shine-Dalgarno (SD) sequence (5'-AAAGGAG-3') was found 9 bp upstream of the initiation codon, ATG. A promoter region corresponding closely to the B. subtilis consensus sequence (-35: TTGACA,-10: TATAAT) was detected, the putative -35 and -10 sequences of which were TTTACA and TATACT, respectively. The deduced amino acid sequence of the cellulolytic xylanase showed 97% homology with that of the alkaline $endo-\beta-1,4-glucanase$ from B. circulans KSM-N257, 75% homology with that of the $endo-\beta-1,3-1,4-glucanase$ from B. circulans WL-12, and 45% homology with that of the $endo-\beta-1,4-glucanase$ (cellulase) from Bacillus sp. KSM-330. The bglBC2 sequence was deposited in Gen-Bank under the accession number AY269256.
Park, Mi Hee;Kim, Seyeon;Song, Yu-ri;Kim, Sumi;Kim, Hyung-Joon;Na, Hee Sam;Chung, Jin
International Journal of Oral Biology
/
v.41
no.1
/
pp.45-51
/
2016
Rutin (3,3',4',5,7-pentahydroxyflavone-3-rhamnoglucoside) is a bioactive flavonoid from the plant kingdom. Rutin has been studied as potential anticancer agent due to its wide range of pharmacological properties including antioxidative, anti-inflammatory and anticancer. Autophagy is a conserved intracellular catabolic pathway to maintain cell homeostasis by formation of autophagosome. Processing of autophagy involves various molecules including ULK1 protein kinase complex, Beclin-1-Vps34 lipid kinase complex, ATG5, ATG12, and LC3 (light chain 3). Cargo-carried autophagosomes fuse with lysosomes resulting in autophagolysosome to eliminate vesicles and degrade cargo. However, the actions of rutin on autophagy are not clearly understood. In this study, we analyzed the effect of rutin on autophagy and inflammation in cancer cell lines. Interestingly, rutin induced autophagy in leukemia (THP-1), oral (CA9-22), and lung (A549) cell lines. TNF-${\alpha}$, key modulator of inflammation, was upregulated by inhibition of rutin-induced autophagy. Taken together, these data indicated that rutin induced autophagy and consequently suppressed TNF-${\alpha}$ production.
The objective of this study was to examine the effects of high concentrations of glucose on porcine parthenotes developing in vitro. Addition of 55 mM glucose to the culture medium of embryos at the four-cell-stage significantly inhibited blastocyst formation, resulting in fewer cells in blastocyst-stage embryos and increased levels of apoptosis and autophagy compared to control. Quantitative reverse transcriptase (RT) PCR analysis revealed that the expression of pro-apoptotic genes (Caspase 3, Bax and Bak) and autophagy genes (Atg6 and Atg8/Lc3) were increased significantly by the addition of 55 mM glucose to the culture medium compared to control. MitoTracker Green fluorescence revealed a decrease in the overall mitochondrial mass compared to control. However, the addition of 55 mM glucose had no effect on mRNA expression of the nuclear DNA-encoded mitochondrial-related genes, cytochrome oxidase (Cox) 5a, Cox5b and Cox6b1. These results suggest that hyperglycemia reduced the mitochondrial content of porcine embryos developing in vitro and that this may hinder embryonic development to the blastocyst stage and embryo quality by increasing apoptosis and autophagy in these embryos.
Sphingomonas chungbukensis DJ77 is able to metabolize phenanthrene as the sole carbon and energy source. The plasmid pUPX5 includes phnS gene encoding 2-hydroxychromene-2-carboxylate (HCCA) isomerase, which is needed for phenanthrene and naphthanene degradation. We determined the nucleotide sequence of DNA fragment of 3271 bp which included the phnS gene. The fragment included an open reading frame of 594 bp which has ATG initiation codon and TAA termination codon and GGAA ribosomal binding site. The predicted amino acid sequence of the enzyme consists of 198 amino acids. The deduced amino acid sequence of the phnS enzyme exhibited 94% identity with that of the corresponding enzyme in Sphingomonas aromaticivorans F199. The phnS gene is located downstream and in the same operon as phnQ and phnR, encoding a 2,3-dihydroxybiphenyl 1,2-dioxygenase and a ferredoxin component of biphenyl dioxygenase, respectively.
Calli were induced from the petiole explants of Pimpinella brachycarpa on MS medium supplemented with 0.5 mg/L 2,4-D and 0.1 mg/L BA after four weeks of culture. Compact clusters of small and dense cells among these calli were selected and suspension-cultured as the source of embryogenic calli. When transferred to MS medium with 0.1 mg/L NAA, the suspension-cultured cells grew to embryogenic callus. Somatic embryos derived from these embryogenic calli developed into plantlets. The cDNA library was constructed in the embryogenic callus and in order to screen the cDNA library, these cDNAs were plated at a density 1.5 $\times$ 10^5 plaques per 15 cm petridish. Among 19 clones showing preferential hybridization with petiole HD-Zip gene, five clones were obtained after second screening. Four clones among them, were highly homologous to P. brachycarpa shoot-tip Phz4 gene, but one clone, Phc5 was about 1.5 kb which has an extra 163 bp to 5' upstream of Phz4. The Phc5 was 1,531 bp containing poly A tails of 18 bases. ATG start codon for Phc5, was located at position 284 with an open reading frame of 906 by which encodes a polypeptide of 302 amino acids. The Phc5 protein revealed that the polypeptides between 135 and 195 contain a homeodomain as the `leucine zipper' motif.
본 웹사이트에 게시된 이메일 주소가 전자우편 수집 프로그램이나
그 밖의 기술적 장치를 이용하여 무단으로 수집되는 것을 거부하며,
이를 위반시 정보통신망법에 의해 형사 처벌됨을 유념하시기 바랍니다.
[게시일 2004년 10월 1일]
이용약관
제 1 장 총칙
제 1 조 (목적)
이 이용약관은 KoreaScience 홈페이지(이하 “당 사이트”)에서 제공하는 인터넷 서비스(이하 '서비스')의 가입조건 및 이용에 관한 제반 사항과 기타 필요한 사항을 구체적으로 규정함을 목적으로 합니다.
제 2 조 (용어의 정의)
① "이용자"라 함은 당 사이트에 접속하여 이 약관에 따라 당 사이트가 제공하는 서비스를 받는 회원 및 비회원을
말합니다.
② "회원"이라 함은 서비스를 이용하기 위하여 당 사이트에 개인정보를 제공하여 아이디(ID)와 비밀번호를 부여
받은 자를 말합니다.
③ "회원 아이디(ID)"라 함은 회원의 식별 및 서비스 이용을 위하여 자신이 선정한 문자 및 숫자의 조합을
말합니다.
④ "비밀번호(패스워드)"라 함은 회원이 자신의 비밀보호를 위하여 선정한 문자 및 숫자의 조합을 말합니다.
제 3 조 (이용약관의 효력 및 변경)
① 이 약관은 당 사이트에 게시하거나 기타의 방법으로 회원에게 공지함으로써 효력이 발생합니다.
② 당 사이트는 이 약관을 개정할 경우에 적용일자 및 개정사유를 명시하여 현행 약관과 함께 당 사이트의
초기화면에 그 적용일자 7일 이전부터 적용일자 전일까지 공지합니다. 다만, 회원에게 불리하게 약관내용을
변경하는 경우에는 최소한 30일 이상의 사전 유예기간을 두고 공지합니다. 이 경우 당 사이트는 개정 전
내용과 개정 후 내용을 명확하게 비교하여 이용자가 알기 쉽도록 표시합니다.
제 4 조(약관 외 준칙)
① 이 약관은 당 사이트가 제공하는 서비스에 관한 이용안내와 함께 적용됩니다.
② 이 약관에 명시되지 아니한 사항은 관계법령의 규정이 적용됩니다.
제 2 장 이용계약의 체결
제 5 조 (이용계약의 성립 등)
① 이용계약은 이용고객이 당 사이트가 정한 약관에 「동의합니다」를 선택하고, 당 사이트가 정한
온라인신청양식을 작성하여 서비스 이용을 신청한 후, 당 사이트가 이를 승낙함으로써 성립합니다.
② 제1항의 승낙은 당 사이트가 제공하는 과학기술정보검색, 맞춤정보, 서지정보 등 다른 서비스의 이용승낙을
포함합니다.
제 6 조 (회원가입)
서비스를 이용하고자 하는 고객은 당 사이트에서 정한 회원가입양식에 개인정보를 기재하여 가입을 하여야 합니다.
제 7 조 (개인정보의 보호 및 사용)
당 사이트는 관계법령이 정하는 바에 따라 회원 등록정보를 포함한 회원의 개인정보를 보호하기 위해 노력합니다. 회원 개인정보의 보호 및 사용에 대해서는 관련법령 및 당 사이트의 개인정보 보호정책이 적용됩니다.
제 8 조 (이용 신청의 승낙과 제한)
① 당 사이트는 제6조의 규정에 의한 이용신청고객에 대하여 서비스 이용을 승낙합니다.
② 당 사이트는 아래사항에 해당하는 경우에 대해서 승낙하지 아니 합니다.
- 이용계약 신청서의 내용을 허위로 기재한 경우
- 기타 규정한 제반사항을 위반하며 신청하는 경우
제 9 조 (회원 ID 부여 및 변경 등)
① 당 사이트는 이용고객에 대하여 약관에 정하는 바에 따라 자신이 선정한 회원 ID를 부여합니다.
② 회원 ID는 원칙적으로 변경이 불가하며 부득이한 사유로 인하여 변경 하고자 하는 경우에는 해당 ID를
해지하고 재가입해야 합니다.
③ 기타 회원 개인정보 관리 및 변경 등에 관한 사항은 서비스별 안내에 정하는 바에 의합니다.
제 3 장 계약 당사자의 의무
제 10 조 (KISTI의 의무)
① 당 사이트는 이용고객이 희망한 서비스 제공 개시일에 특별한 사정이 없는 한 서비스를 이용할 수 있도록
하여야 합니다.
② 당 사이트는 개인정보 보호를 위해 보안시스템을 구축하며 개인정보 보호정책을 공시하고 준수합니다.
③ 당 사이트는 회원으로부터 제기되는 의견이나 불만이 정당하다고 객관적으로 인정될 경우에는 적절한 절차를
거쳐 즉시 처리하여야 합니다. 다만, 즉시 처리가 곤란한 경우는 회원에게 그 사유와 처리일정을 통보하여야
합니다.
제 11 조 (회원의 의무)
① 이용자는 회원가입 신청 또는 회원정보 변경 시 실명으로 모든 사항을 사실에 근거하여 작성하여야 하며,
허위 또는 타인의 정보를 등록할 경우 일체의 권리를 주장할 수 없습니다.
② 당 사이트가 관계법령 및 개인정보 보호정책에 의거하여 그 책임을 지는 경우를 제외하고 회원에게 부여된
ID의 비밀번호 관리소홀, 부정사용에 의하여 발생하는 모든 결과에 대한 책임은 회원에게 있습니다.
③ 회원은 당 사이트 및 제 3자의 지적 재산권을 침해해서는 안 됩니다.
제 4 장 서비스의 이용
제 12 조 (서비스 이용 시간)
① 서비스 이용은 당 사이트의 업무상 또는 기술상 특별한 지장이 없는 한 연중무휴, 1일 24시간 운영을
원칙으로 합니다. 단, 당 사이트는 시스템 정기점검, 증설 및 교체를 위해 당 사이트가 정한 날이나 시간에
서비스를 일시 중단할 수 있으며, 예정되어 있는 작업으로 인한 서비스 일시중단은 당 사이트 홈페이지를
통해 사전에 공지합니다.
② 당 사이트는 서비스를 특정범위로 분할하여 각 범위별로 이용가능시간을 별도로 지정할 수 있습니다. 다만
이 경우 그 내용을 공지합니다.
제 13 조 (홈페이지 저작권)
① NDSL에서 제공하는 모든 저작물의 저작권은 원저작자에게 있으며, KISTI는 복제/배포/전송권을 확보하고
있습니다.
② NDSL에서 제공하는 콘텐츠를 상업적 및 기타 영리목적으로 복제/배포/전송할 경우 사전에 KISTI의 허락을
받아야 합니다.
③ NDSL에서 제공하는 콘텐츠를 보도, 비평, 교육, 연구 등을 위하여 정당한 범위 안에서 공정한 관행에
합치되게 인용할 수 있습니다.
④ NDSL에서 제공하는 콘텐츠를 무단 복제, 전송, 배포 기타 저작권법에 위반되는 방법으로 이용할 경우
저작권법 제136조에 따라 5년 이하의 징역 또는 5천만 원 이하의 벌금에 처해질 수 있습니다.
제 14 조 (유료서비스)
① 당 사이트 및 협력기관이 정한 유료서비스(원문복사 등)는 별도로 정해진 바에 따르며, 변경사항은 시행 전에
당 사이트 홈페이지를 통하여 회원에게 공지합니다.
② 유료서비스를 이용하려는 회원은 정해진 요금체계에 따라 요금을 납부해야 합니다.
제 5 장 계약 해지 및 이용 제한
제 15 조 (계약 해지)
회원이 이용계약을 해지하고자 하는 때에는 [가입해지] 메뉴를 이용해 직접 해지해야 합니다.
제 16 조 (서비스 이용제한)
① 당 사이트는 회원이 서비스 이용내용에 있어서 본 약관 제 11조 내용을 위반하거나, 다음 각 호에 해당하는
경우 서비스 이용을 제한할 수 있습니다.
- 2년 이상 서비스를 이용한 적이 없는 경우
- 기타 정상적인 서비스 운영에 방해가 될 경우
② 상기 이용제한 규정에 따라 서비스를 이용하는 회원에게 서비스 이용에 대하여 별도 공지 없이 서비스 이용의
일시정지, 이용계약 해지 할 수 있습니다.
제 17 조 (전자우편주소 수집 금지)
회원은 전자우편주소 추출기 등을 이용하여 전자우편주소를 수집 또는 제3자에게 제공할 수 없습니다.
제 6 장 손해배상 및 기타사항
제 18 조 (손해배상)
당 사이트는 무료로 제공되는 서비스와 관련하여 회원에게 어떠한 손해가 발생하더라도 당 사이트가 고의 또는 과실로 인한 손해발생을 제외하고는 이에 대하여 책임을 부담하지 아니합니다.
제 19 조 (관할 법원)
서비스 이용으로 발생한 분쟁에 대해 소송이 제기되는 경우 민사 소송법상의 관할 법원에 제기합니다.
[부 칙]
1. (시행일) 이 약관은 2016년 9월 5일부터 적용되며, 종전 약관은 본 약관으로 대체되며, 개정된 약관의 적용일 이전 가입자도 개정된 약관의 적용을 받습니다.