• 철학연구
• /
• 제105권
• /
• pp.49-74
• /
• 2008

본 연구의 목적은 토미즘에 있어서 '인간적 행위'가 가지는 '자기초월의 성격'을 조명하는 데에 있다. 토미즘에 있어서 이성과 의지를 가진 인간의 본성은 궁극적인 목적에로 지향성을 가진 것이며, 따라서 '인간의 행위'가 아닌 '인간적 행위'란 이러한 본성에 적합한 행위를 말하며, 현재의 상태보다 더 낳은 상태를 지향하는 '자기초월'을 성격을 가지는 것이다. 물론 이러한 자기초월적 성격을 본질적으로 가지게 되는 인간적 행위의 근거는 인간의 형상인 이성혼(理性魂)이 '자립적인 형상'이라는 데에 있다. 토마스 아퀴나스에게 있어서 이러한 인간적 행위의 자기초월의 성격은 크게 세 가지 단계를 거친다고 볼 수 있는데, (1)자연적 진보의 질서 안에서의 초월, (2)도덕적 질서 안에서의 자기초월 그리고 (3)종교적 삶에 있어서 자기초월이 그것이다. 자연적 진보에서는 우선적으로 이성적 영혼의 특성에서 드러나는데, 아퀴나스는 인간의 이성적인 덕을 '나약함 안에서의 충만함'이라고 규정하는데, 이는 이성적인 덕이란 '외적 감각능력들의 목적지($finalit{\acute{e}}$)'로서 고려하기 때문이다. 외적 감각을 통해서 인간은 '감각적 상(especies sensibilis)'들을 수용하며, 이미지들을 보존하고, 이 이미지들은 기억 혹은 추억이라는 형태로 그의 실존의 일부가 되며, 자기의식을 의미하는 정신적인 실재가 되는 것이다. 따라서 토마스에게 있어서 이성의 덕은 단순히 사변적인 능력이 아니라, '되어짐'의 질서, 충만함의 질서 안에 있는 것이다. 바로 이 때문에 토마스는 이성(ratio)의 능력을 '생성(generatio)'에 비유하고 있으며, 지성(intellectus)을 존재(esse)에 비유하고 있는 것이다. 즉 이성은 감각을 초월하고, 지성은 이성을 초월하는 것이다. 도덕적 질서 안에서의 자기초월은 의식의 진보와 관련되어 있는데, 인간의 의식은 언제나 이중적인데, 일차적으로 외부대상에 대한 인식이요, 이차적으로 이러한 외부대상에 대한 인식의 결과라 할 수 있는 자기의식(contientia)이다. 즉 이러한 외부대상에 대한 인식은 근본적으로 자기의식 혹은 자기인식을 목적으로 하며, 자기인식에서 완성된다. 자기의식은 '자기동일성'에 대한 의식을 말하는데, 여기서 인간의 특유한 도덕적 행위가 발생한다. 즉 당위 혹은 의무라는 것은 언제나 '자기동일성'에 대한 적합성을 의미하는 것이며, 이러한 행위가 지속적일 때, 도덕적 삶이 발생하는 것이다. 도덕적 삶이 그 자체 초월적인 성격을 가지는 것은 '자기동일성'에 적합한 인간적 행위란 언제나 '보다 나은 것' 보다 '이상적인 삶'을 지향하기 때문이다. 종교적 삶에 있어서 토미즘의 특성을 보다 잘 부각하기 위해서 본 논문에서는 키엘케고올의 종교적 삶에 대한 초월성을 우선적으로 고찰하고 있는데, 그에 의하면 종교적 삶에 있어서 초월적 성격은 '절대적 차원의 초월'로서 근본적으로 합리적으로 기술되거나 표현될 수 있는 모든 문화적인 인간적인 지평을 넘어서는 '초월' 즉 '절대적 초월($d{\acute{e}}passement$ absolu)을 의미하는 것이다. 반면 아퀴나스에게 있어서 신과 인간 사이의 '친근성($affinit{\acute{e}}$)'은 수용된 덕들(virtutes infusas)이 있는 곳에는 반드시 일종의 종교적인 초월이 수반된다. '가능태'중에 있는 하나의 (수용된)덕이 '현실태'가 되는 곳에는 반드시 '자기초월'의 행위가 수반되는 것이다. 왜냐하면 이러한 수용된 덕의 국면은 신과 인간 사이의 소통을 말해주고 있기 때문이며, 이는 곧 '인간적인 것'에서 '신성한 것'에로의 초월을 암시하고 있기 때문이다. 이러한 아퀴나스의 사유는 구체적이고 개별적인 한 인간의 종교적인 삶 안에서 '자기초월'이 이루어지는 곳에는 언제나 신의 섭리가 개입하고 있다는 실재론적인 사유를 가능하게 하고 있는 것이다.

• 미생물학회지
• /
• 제46권2호
• /
• pp.223-227
• /
• 2010

RNase E는 대장균 내에 있는 수많은 RNA의 분해와 가공에 관여하며, 또한 RNA 대사 작용에 관련된 거대한 단백질 복합체인 데그라도좀을 구성하는 중요한 효소로 알려져 있다. RraA와 RraB는 최근에 밝혀진 RNase E의 단백질 저해제이며, 진화적으로 잘 보존되어 있다. 이 연구에서는 RraA를 발현 시킬 때와는 달리 세포 내에서 RraB를 발현 시키면, RNase E의 과발현에 따른 세포의 성장 저해를 회복시키지 못하고 더 저해하는 것을 확인하였다. 이 현상이 RraA와 RraB가 세포내 RNase E의 기질들에 대해 특이적으로 영향을 미치기 때문인지를 알아보기 위해 세 개의 RNase E 기질을 분석하였다. 그 결과, ColE1-타입 플라스미드의 복제수를 조절하는 RNA I과 라이보좀 단백질 S15를 코딩하는 rpsO mRNA의 경우 RraA가 RraB 보다 효과적으로 RNase E의 활성을 저해하며, RNase P의 RNA 구성요소의 전구체인 pM1 RNA에 대한 RNase E의 효소 활성은 RraB가 저해하지 못하는 것을 관찰하였다. 이 결과는 RraB가 RraA보다는 높은 기질 특이적으로 RNase E의 효소활성을 저해하며, 이러한 이유로 RNase E의 과발현에 의한 세포의 성장 저해를 RraB의 과발현으로 극복할 수 없었다고 추론할 수 있다.

• 철학연구
• /
• 제131권
• /
• pp.303-330
• /
• 2014

죽음에 대한 철학자들의 입장은 자신들의 세계관에 따라서 다양하게 달라지고 있다. 죽음을 무시함으로서 죽음에 대한 두려움을 극복하고자 하기도 하며, 오히려 죽음에 대한 명상을 통해서 보다 진정한 삶을 살고자 하기도 한다. 키르케고르의 사상 안에서 죽음의 개념은 매우 중요한 키워드처럼 등장하는데, 이는 죽음이라는 주제를 통해서 보다 밀도 있고 진정한 삶을 말하고자 하는 것을 의미한다. 그의 사상에서 죽음이란 세속적인 삶으로부터의 죽음 혹은 자기부정을 말하고 있다. 그 이유는 인간은 근원적으로 문제적인 존재임과 동시에 영원적인 것을 함께 지니고 있는 존재라는 그의 인간관 때문이다. 인간의 현재의 삶에 대한 절망은 영적인 죽음을 의미하는 '죽음에 이르는 병'에 이를 수도 있고, 또한 '자기부정'을 통해 단독자로서 절대자 앞에 나아갈 수도 있다. 인간이 자기부정을 통해서 진정 실존적으로 될 수 있는 것이 곧 '진지함'을 의미하는데, 진지함의 부재(不在)는 정신적 존재 혹은 영적인 존재로서의 '자기 자신'의 부재(不在)를 의미한다. '죽음에 대해 진지한 사유'란 죽음을 자신의 현존재의 일부처럼 진지하게 받아들이는 사유를 의미하며, 이러한 '진지함'을 '영원과 맞닿아 있는 현실의 삶'이라는 '현재에 충실함'을 가능하게 하는 에너지원처럼 이해하고 있다. 이러한 죽음에 대한 그의 사유는 육체적인 죽음이 영원성으로서의 생명에 비하면 아주 사소한 일에 불과하고, 오히려 죽음 이후에 진정으로 의인들이 갈망하였던 그러한 삶이 충만하게 실현될 것이라는 종교적인 확신을 가능하게 하고 있다. 이러한 키르케고르의 사유는 죽음에 대한 '체험된 실재'라는 차원에서 '죽음에 대한 형이상학적 의미'를 말해주는 것이며, 또한 '철학이란 죽음을 배우는 것'이라는 고대철인들의 지혜를 그리스도교적 관점에서 해명하는 사유라고 할 것이다.

• 한국문헌정보학회지
• /
• 제9권
• /
• pp.53-74
• /
• 1982

On admet Jusqu'ici que le XVe siecle est une $\acute{e}poque$ phare de l'histoire de l'imprimerie avec l'apparition de la typographie en Orient et en Occident, $c'est-\acute{a}-dire$ en $Cor\acute{e}e$ sur le Rhim. Cependant, $l'\acute{e}poque$ de l'invention typographique en $Cor\acute{e}e$ doit $\hat{e}tre$ $devanc\acute{e}e$ encore d'un ou deux siecle. Outre cette question, il est $\acute{a}$ noter ici que les caracteres mobiles $m\acute{e}talliques$ Kyemi, fondus en 1403, ont $jou\acute{e}$ un $r\hat{o}le$ $tr\acute{e}s$ important dans l'histoire de la typographie mondiale et que les $caract\acute{e}res$ kabin qui leur $succ\acute{e}derent$ en 1434 menerent la typographie $cor\acute{e}enne$ a son $apog\acute{e}e$. Or, les recherches $cor\acute{e}ennes$ se satifait de la primaute de l'invention en Coree des caracteres mobiles metalliques, mais n'adoptent pas une attitude suffisament critique. Aussi, l'auteur a-toil voulu s'interroger sur la veritable valeur de la typographie de la dynastie de Choson tant au point de vue de l'histoire de l'imprimerie mondiale. En premier lieu, on etudie, comme une chronique, les caracteres mobiles metalliques importants tout au long de la dynastie de Choson sans donner une interpretation nouvelle. C'est dans deux derniers, qu'on essaie de developper ses idees sur la typographie en Coree notamment la question technologique qui devrait etre le fond des recherches. Aussi, on y etudie, la technique de la typographie ancienne en Coree interpretee selon une methode scientifique et moderne et, enfin, le bilan synthetique en cherchant les raisons qui freinerent son developpement en Coree malgre la performance de ses debuts. A l'issue de ces recherches, on ne peut s'empecher d'eprouver une certaine insatisfaction a cause de l'ambiguite des explications que l'on trouve dans des documents fondamentaux. Avec ce difficulte on a voulu, au moins, exposer des points discutatables qui devraient etre les recherches a futur.

• 식물분류학회지
• /
• 제41권3호
• /
• pp.259-266
• /
• 2011

Elsholtzia hallasanensis, E. springia, and E. splendens var. fasciflora (Lamiaceae) were reported recently as new species or new varieties of E. splendens according to their morphological characteristics. To reappraise the taxonomic status of these additional taxa and to determine the relationships between all Korean Elsholtzia taxa except E. saxatilis, which is distributed in North Korea, molecular studies based on the nrDNA (ITS) and cpDNA (rpl16, and trnH-psbA) sequences of seven taxa of Elsholtzia and one outgroup were carried out. The molecular data support that E. angustifolia and E. minima are distinct species from E. splendens and E. ciliata, respectively, because they have several private marker genes and show monophyly. The molecular data also support that E. splendens has a very close taxonomic relationship with both E. hallasanensis and E. springia. We found that E. splendens var. fasciflora, with multiple inflorescence, was based on several private marker genes and on the monophyly of its trees, suggesting that it can be considered as a variety. Elsholtzia springia, with the same sequences and the same morphological characteristics with E. hallasanensis after transplanting, should be treated as a synonym of E. hallasanensis. Moreover, we consider the taxonomic status of E. hallasanensis as E. splendens var. hallasanensis (Y. Lee) N.S. Lee & C.S. Lee, stat. nov.

• Journal of Plant Biology
• /
• 제35권2호
• /
• pp.155-163
• /
• 1992

식물세포에 tumor를 유발하는 Agrobacterium tumefaciens pTiA6 plasmid에서 virE 유전자의 발현조절기작을 분자적수준에서 규명하기 위하여 virE promoter의 5＇-말단을 제거하여 얻은 truncated virE 재조합플라스미드를 이용하여 virE promoter의 조절부위에 대하여 연구하였다. virE promoter의 기능이 존재하는 truncated virE 재조합플라스미드인 pJS201은 전기영동에 의하여 virE promoter의 5＇-말단으로부터 약 130개의 염기가 제거된 것으로 측정되었다. 한편 virE promoter의 기능을 상실한 pJS301에서 dideoxy chain termination방법으로 truncated virE promoter 염기서열을 결정한 결과 263개의 염기가 제거된 것으로 확인되었다. 따라서 virE promoter의 조절부위는 virE promoter의 5＇-말단으로부터 약 130번째의 염기에서 263번째의 염기사이에 존재하는 것으로 사료되며, 이 사이에 23개의 염기로 이루어진 역반복서열(AACTTTGCGCTATAGGCAAAGTT)이 존재하고 있는데, 이 부위가 virE operon의 발현에 있어서 RNA polymerase의 최초 인식부위(recognition site)일 것으로 사료된다.

• International Journal of Contents
• /
• 제11권4호
• /
• pp.44-55
• /
• 2015

There has been a significant paradigm shift in the book industry from print to digital, with the increased use of electronic books (e-books) on e-book readers. The major online booksellers and publishers are devoting their energies to the growth of the e-book market, resulting in an upward spiral in e-book usage, and a resultant increase in the number of downloaded e-books in an e-book reader library. However, there are comparatively few features for e-book management and search in most e-book reader libraries, particularly in smartphone environments. In addition, the user interfaces of e-book management in e-book readers are highly diverse, which has led to major usability issues. In this paper, we analyze user preferences for e-book management and search in the libraries of the five most commonly used e-readers for the Android smartphone platform via a questionnaire survey. Then, we suggest ideal alternatives in addition to user-friendly features based on user preferences for managing e-book libraries, to allow users to more easily browse collections, thereby enhancing the usability of e-book readers.

• 통상정보연구
• /
• 제5권1호
• /
• pp.39-59
• /
• 2003

The purpose of this paper is to examine the possibility of whether B2B e-marketplaces continue to grow. There are numerous barriers to the growth of e-marketplace, but certain key factors can push e-marketplaces beyond these obstacles. In the stage of generating traffic, it is essential to find a vertical area to attract buyers and sellers which can generate B2B transaction through e-marketplace. Generating traffic is possible only for e-marketplaces established by those who have vertical knowledges and strong off-line relationship in the vertical areas. In the stage of concentrating traffic, more attention should be given to reach critical mass and to increase transaction through e-marketplace. Currently, there seems to be a tendency that having major buyers as members of a e-marketplace is an true factor for the successful e-marketplace. Finally, to attain the locking traffic, e-marketplace needs to have the ability to generate revenue through B2B transaction. What we have learn from this study is that having the software-technology is not a sufficient condition to successfully operate B2B e-marketplace. It is important for e-marketplace to attract major players in order to increase B2B transaction, and also to make profit by them.

• Bulletin of the Korean Chemical Society
• /
• 제5권1호
• /
• pp.16-21
• /
• 1984

The relative Arrhenius parameters for t-butoxy radical decomposition (log $A_d$, $E_d$) and hydrogen abstraction of t-butoxy radical from hydrogen donor (log $A_d$, $E_d$) by competitive method were obtained as follows: for cyclohexane; log $A_a/A_d$ = -4.17 mole/l and $E_d-E_a$ = 9.01 kcal/mole, for isobutane; log $A_a/A_d$ = -5.70 mole/l and $E_e-E_a$= 11.0 kcal/mole. From the reported Arrhenius parameters for t-Butoxy radical decomposition reactions the parameters for t-Butoxy radical reactions with isobutane and cyclohexane are estimated to be log $A(l/mol{\cdot}sec)$ = 8.4, $E_a$ = 4.3 kcal/mol and $log A (l/mol{\cdot}sec)= 9.9,\;E_a$ = 6.3 kcal/mol, respectively.

• Journal of Animal Science and Technology
• /
• 제53권2호
• /
• pp.107-111
• /
• 2011

본 연구는 제주마의 기본모색 분류체계와 유전 변이간의 관계를 확인하기 위해 수행되었다. pyrosequencing 방법을 이용하여 melanocortin receptor 1 (MC1R)과 agouti signaling protein (ASIP) 유전자의 변이를 분석하였다. MC1R은 g.901C>T 염기치환을 분석하였고, ASIP는 11-bp 결실돌연변이를 분석하였다. 가라마필은 MC1R에서는 $E^+$/- ($E^+/E^+$ or $E^+/E^e$), ASIP에서는 $A^a/A^a$ 유전자형이 나타났다. 유마 마필에서는 MC1R은 $E^+$/- 그리고 ASIP는 $A^A$/- 유전자형이 나타났다. 반면에 적다 마필에서 MC1R은 $E^e/E^e$ 유전자형만이 나타났으며, ASIP에서는 모든 조합의 유전자형이 나타났다. 가라모색과 유마모색은 MC1R에서 적어도 1개의 $E^+$ 우성대립유전자를 갖고 있어야하며, 적다모색에서는 동형열성대립유전자인 $E^e/E^e$ 유전자형을 가져야 한다. 이는 ASIP 유전자형 분포와 관계없이 MC1R 유전자형에 의해 가라/유마모색과 적다모색을 결정하는 것이다. 또한 MC1R은 $E^+$/- 그리고 ASIP은 우성대립유전자인 $A^A$/-를 갖는 마필은 유마모색을 나타내는데 이는 ASIP은 우성대립유전자인 $A^A$에 의해 사지를 제외한 부분에서 흑모색발현을 억제하는 것으로 추정된다. 가계분석에서는 제주마와 더러브렛간에 교배로 생산된 $F_1$ 자마의 기본모색 양상과 MC1R 및 ASIP 유전자형 분포와의 관계에 대해 일정한 결과를 보여주고 있다. 본 결과는 모색에 대한 표현형과 유전양상 간의 관계를 보여주고 있으며, 제주마의 분자육종을 위한 중요한 정보를 제공할 수 있을 것으로 사료된다.