One clone(pANt32) carring tRNA/sup Arg/ gene was selected from Aspergillus total tRNA gene clones. The nucleotide sequences of this tRNA gene were determined by Maxam and Gilbert's chemical cleavage methods. The sequence of this tRNA gene is as follow; 5'GGCCGGCTGCCCAATTGGCAAGGCGTCTGACTACGAATCAGGAGAT TGCAGGTTCGAGCCCTGCGTGGGTCA3'. This sequence conicides with the characteristecs of other eukaryotic tRNA. Some consensus sequences (ACT-TA bow, TATTTT and T-cluster) are found in both 5'-end and 3'-end flanking regions.
In Gram(+) bacteria and organelles in higher eukarotes, $Gln-tRNA^{Gln}$ utilized for protein biosynthesis is formed by a tRNA-dependent amino acid transformation using mischarged $Gln-tRNA^{Gln}$ as the intermediate. In this study, the gatCAB gene encoding $Gln-tRNA^{Gln}$ amidotransferase (Glu-AdT) of Staphylococcus aureus was cloned and its nucleotide sequence wa determined. The S. aureus gatCAB gene was organized in an operon structure consisting of three open reading frames (gatC, gatA, and gatB), similar to that of Bacillus subtilis. The gene sequences for the A and B subunits of$Gln-tRNA^{Gln}$ amidotransferase showed significant homology (77 and 87% homology with amino acid sequence) with the gatA and gatB genes of B. subtilis, yet the C subunit (gatC) showed a relatively lowe homology with the B. subtilis gatC gene and other orthologues. The cloned S. aureus <$Gln-tRNA^{Gln}$ amidotransferase gene was highly expressed in Escherichia coli, and the resulting crude enzyme could convert misacylated <$Gln-tRNA^{Gln}$ into $Gln-tRNA^{Gln}$ in vitro.
The genetic variations among six species of Rana from Korea (R. nigro-maculata, R. piancyi, R. dybowskii, R. sp, R. rugosa type A, B and R. amurensis) were investigated using 499 bases of mitochondrial DNA sequences for ND2 (NADH dehydrogenase subunit 2) gene and $tRNA^{Trp}$ gene. Partial sequences of ND2 gene (427 bp) and full sequences of $tRNA^{Trp}$ gene (73 bp) were identified. The level of sequence divergences ranged from 0.2 to 5.2% within species and 4.9-28.0% among 6 species of the genus Rana. The $tRNA^{Trp}$ gene of the genus Rana was composed of 77 nucleotides which showed a two dimensional "cloverleaf" structure. The secondary structure of $tRNA^{Trp}$ was not found compensatory changes which could potentially confound phylogenetic inference. In the neighborjoining tree, brown frogs were clustered first with the level of sequence divergence of 13.20% between R. amurensis and R. dybowskii, and 9% between R. dybowskii and R. sp. supported by 99% bootstrap iterations, respectively. R. nigromaculata and R. plancyi were clustered into another group with 5.1% divergence supported by 100% bootstrap iteration. R. rugosa A 8nd B types were grouped by 4.9% divergence and clustered into the last group with other two groups with 100% bootstrap iterations.
Bacteriophage T4 tRNA processing in E. coli mutant strains defective in RNase Ⅲ, RNase E$^-$, and RNase P, respectively, singly or in combinations, was investigated. In $RNase E^- strains, a RNA band, which would be referred as 9S RNA, accumulates, while in RNase$ P^-$ strains, lower band of 6S double band is accumulated. In RNase III$^-$ strains, the production of tRAN$^{Gln}$ coded by T4 tRNA gene cluster, is severely depressed and also production of species 1 RNA, which is coded by T4 DNA but not by the tRNA gene cluster, is in somewhat depressed amounts; on the other hand, at the same time, an upper band of 6S double bands, coded by T4 tRNA gene cluster, is accumulated in rather greater amounts as compared to the RNase $^+$ strain. The upper band RNA of the 6S double band, however, does not appear to be a precursor to the tRNA$^{Gln}$. The present work points to the lack of evidence for an essential cleavage role of RNase Ⅲ, although there must be a role for the RNase Ⅲ in the T4 tRNA processing.
There are three pseudourdine ($Psi$)bases in the E. coli $tRNA^{phe}$ In order to study the function of the pseudouridine bases in the $tRNA^{phe}$, changes of bases $tRNA^{phe}$ gene to other bases were undertaken by the site-specific mutagenesis. Site-specific mutagenesis of T in the pheW gene, a $tRNA^{phe}$ gene of E. coli, corresponding to the baseat the No.32 position to C and also T corresponding to the base at the No.39 position to C were performed using Kunkel's uracil-containing template method. Identification of mutants were undertaken by the KNA sequencing techniques of the mutated pheW genes and activities of the mutated pheW genes complementing to E. coli NP37 mutant($pheS^{-ts}$) using the recombinant plasmid containing the mutated genes. Neither NP37 harboring pheW gene mutated at No.32 position nor NP37 harboring pheW gene mutated at No.39 position can be grown at non-permissive temperature. The result means that both mutated pheW genes can not complement to E. coli NP37, and that the pseudouridine bases are essential to the activity of the E. coli $tRNA^{phe}$ in vivo.
Kim, Na-Young;Baek, Jin-Young;Choi, Hong-Seok;Chung, In-Sik;Shin, Sung-Ho;Lee, Jung-Ihn;Choi, Jung-Yun;Yang, Jai-Myung
Journal of Microbiology and Biotechnology
/
v.22
no.2
/
pp.190-198
/
2012
RNA interference (RNAi) is rapidly becoming a valuable tool in biological studies, as it allows the selective and transient knockdown of protein expression. The short-interfering RNAs (siRNAs) transiently silence gene expression. By contrast, the expressed short-hairpin RNAs induce long-term, stable knockdown of their target gene. Trichoplusia ni (T. ni) cells are widely used for mammalian cell-derived glycoprotein expression using the baculovirus system. However, a suitable shRNA expression system has not been developed yet. We investigated the potency of shRNA-mediated gene expression inhibition using human and Drosophila U6 promoters in T. ni cells. Luciferase, EGFP, and ${\beta}$-N-acetylglucosaminidase (GlcNAcase) were employed as targets to investigate knockdown of specific genes in T. ni cells. Introduction of the shRNA expression vector under the control of human U6 or Drosophila U6 promoter into T. ni cells exhibited the reduced level of luciferase, EGFP, and ${\beta}$-N-acetylglucosaminidase compared with that of untransfected cells. The shRNA was expressed and processed to siRNA in our vector-transfected T. ni cells. GlcNAcase mRNA levels were down-regulated in T. ni cells transfected with shRNA vectors-targeted GlcNAcase as compared with the control vector-treated cells. It implied that our shRNA expression vectors using human and Drosophila U6 promoters were applied in T. ni cells for the specific gene knockdown.
RNA metabolism plays a central role in regulating of T cell-mediated immunity. RNA processing, modifications, and regulations of RNA decay influence the tight and rapid regulation of gene expression during T cell phase transition. Thymic selection, quiescence maintenance, activation, differentiation, and effector functions of T cells are dependent on selective RNA modulations. Recent technical improvements have unveiled the complex crosstalk between RNAs and T cells. Moreover, resting T cells contain large amounts of untranslated mRNAs, implying that the regulation of RNA metabolism might be a key step in controlling gene expression. Considering the immunological significance of T cells for disease treatment, an understanding of RNA metabolism in T cells could provide new directions in harnessing T cells for therapeutic implications.
A gene can be selectively overexpressed in E. coli by utilizing the phage T7 RNA polymerase's stringent recognition and active transcription of the T7 promoter. The T7 expression system was constructed such that the T7 RNA polymerase gene is under the control of lacUV5 promoter in one plasmid, and that the target gene, the promoterless chloramphenicol acetyltransferase (CAT) gene with E. coli ribosome binding site is under the control of T7 promoter in the other plasmid. Only the E. coli cells containing both plasmids show high resistance to chloramphenicol. When the copy number of the runaway plasmid containing the polymerase gene was varied by a temperature shift, amounts of the CAT protein synthesized upon induction was correspondingly changed as shown in SDS gel electrophoresis.
This study was performed to verify the gene expression of 3T3-L1 using the siRNA of the aromatase gene, which is the estrogen synthesis enzymes. First of all three pairs of siRNA were designed from the CYP19A1 (aromatase) and analyzed the formation of fat cell mechanism by transferring gene to 3T3-L1 and differentiating it. As a result, the expression of leptin gene, which is the main gene causing the obesity, was controlled and the cause of the obesity is related with the insulin specifically. The overexpression of adiponectin and adipsin was observed. This result showed that the formation of the fat was controlled a little without any side effect by obstructing a specific material out of all the signal systems in the fat formation. This study will be an important clue to make it clear that the lack or overexpression of estrogen might be the cause of fat formation mechanism.
Because of an increased number of Acanthamoeba keratitis (AK) along with associated disease burdens, medical professionals have become more aware of this pathogen in recent years. In this study, by analyzing both the nuclear 18S small subunit ribosomal RNA (18S rRNA) and mitochondrial 16S rRNA gene loci, 27 clinical Acanthamoeba strains that caused AK in Japan were classified into 3 genotypes, T3 (3 strains), T4 (23 strains), and T5 (one strain). Most haplotypes were identical to the reference haplotypes reported from all over the world, and thus no specificity of the haplotype distribution in Japan was found. The T4 sub-genotype analysis using the 16S rRNA gene locus also revealed a clear subconformation within the T4 cluster, and lead to the recognition of a new sub-genotype T4i, in addition to the previously reported sub-genotypes T4a-T4h. Furthermore, 9 out of 23 strains in the T4 genotype were identified to a specific haplotype (AF479533), which seems to be a causal haplotype of AK. While heterozygous nuclear haplotypes were observed from 2 strains, the mitochondrial haplotypes were homozygous as T4 genotype in the both strains, and suggested a possibility of nuclear hybridization (mating reproduction) between different strains in Acanthamoeba. The nuclear 18S rRNA gene and mitochondrial 16S rRNA gene loci of Acanthamoeba spp. possess different unique characteristics usable for the genotyping analyses, and those specific features could contribute to the establishment of molecular taxonomy for the species complex of Acanthamoeba.
본 웹사이트에 게시된 이메일 주소가 전자우편 수집 프로그램이나
그 밖의 기술적 장치를 이용하여 무단으로 수집되는 것을 거부하며,
이를 위반시 정보통신망법에 의해 형사 처벌됨을 유념하시기 바랍니다.
[게시일 2004년 10월 1일]
이용약관
제 1 장 총칙
제 1 조 (목적)
이 이용약관은 KoreaScience 홈페이지(이하 “당 사이트”)에서 제공하는 인터넷 서비스(이하 '서비스')의 가입조건 및 이용에 관한 제반 사항과 기타 필요한 사항을 구체적으로 규정함을 목적으로 합니다.
제 2 조 (용어의 정의)
① "이용자"라 함은 당 사이트에 접속하여 이 약관에 따라 당 사이트가 제공하는 서비스를 받는 회원 및 비회원을
말합니다.
② "회원"이라 함은 서비스를 이용하기 위하여 당 사이트에 개인정보를 제공하여 아이디(ID)와 비밀번호를 부여
받은 자를 말합니다.
③ "회원 아이디(ID)"라 함은 회원의 식별 및 서비스 이용을 위하여 자신이 선정한 문자 및 숫자의 조합을
말합니다.
④ "비밀번호(패스워드)"라 함은 회원이 자신의 비밀보호를 위하여 선정한 문자 및 숫자의 조합을 말합니다.
제 3 조 (이용약관의 효력 및 변경)
① 이 약관은 당 사이트에 게시하거나 기타의 방법으로 회원에게 공지함으로써 효력이 발생합니다.
② 당 사이트는 이 약관을 개정할 경우에 적용일자 및 개정사유를 명시하여 현행 약관과 함께 당 사이트의
초기화면에 그 적용일자 7일 이전부터 적용일자 전일까지 공지합니다. 다만, 회원에게 불리하게 약관내용을
변경하는 경우에는 최소한 30일 이상의 사전 유예기간을 두고 공지합니다. 이 경우 당 사이트는 개정 전
내용과 개정 후 내용을 명확하게 비교하여 이용자가 알기 쉽도록 표시합니다.
제 4 조(약관 외 준칙)
① 이 약관은 당 사이트가 제공하는 서비스에 관한 이용안내와 함께 적용됩니다.
② 이 약관에 명시되지 아니한 사항은 관계법령의 규정이 적용됩니다.
제 2 장 이용계약의 체결
제 5 조 (이용계약의 성립 등)
① 이용계약은 이용고객이 당 사이트가 정한 약관에 「동의합니다」를 선택하고, 당 사이트가 정한
온라인신청양식을 작성하여 서비스 이용을 신청한 후, 당 사이트가 이를 승낙함으로써 성립합니다.
② 제1항의 승낙은 당 사이트가 제공하는 과학기술정보검색, 맞춤정보, 서지정보 등 다른 서비스의 이용승낙을
포함합니다.
제 6 조 (회원가입)
서비스를 이용하고자 하는 고객은 당 사이트에서 정한 회원가입양식에 개인정보를 기재하여 가입을 하여야 합니다.
제 7 조 (개인정보의 보호 및 사용)
당 사이트는 관계법령이 정하는 바에 따라 회원 등록정보를 포함한 회원의 개인정보를 보호하기 위해 노력합니다. 회원 개인정보의 보호 및 사용에 대해서는 관련법령 및 당 사이트의 개인정보 보호정책이 적용됩니다.
제 8 조 (이용 신청의 승낙과 제한)
① 당 사이트는 제6조의 규정에 의한 이용신청고객에 대하여 서비스 이용을 승낙합니다.
② 당 사이트는 아래사항에 해당하는 경우에 대해서 승낙하지 아니 합니다.
- 이용계약 신청서의 내용을 허위로 기재한 경우
- 기타 규정한 제반사항을 위반하며 신청하는 경우
제 9 조 (회원 ID 부여 및 변경 등)
① 당 사이트는 이용고객에 대하여 약관에 정하는 바에 따라 자신이 선정한 회원 ID를 부여합니다.
② 회원 ID는 원칙적으로 변경이 불가하며 부득이한 사유로 인하여 변경 하고자 하는 경우에는 해당 ID를
해지하고 재가입해야 합니다.
③ 기타 회원 개인정보 관리 및 변경 등에 관한 사항은 서비스별 안내에 정하는 바에 의합니다.
제 3 장 계약 당사자의 의무
제 10 조 (KISTI의 의무)
① 당 사이트는 이용고객이 희망한 서비스 제공 개시일에 특별한 사정이 없는 한 서비스를 이용할 수 있도록
하여야 합니다.
② 당 사이트는 개인정보 보호를 위해 보안시스템을 구축하며 개인정보 보호정책을 공시하고 준수합니다.
③ 당 사이트는 회원으로부터 제기되는 의견이나 불만이 정당하다고 객관적으로 인정될 경우에는 적절한 절차를
거쳐 즉시 처리하여야 합니다. 다만, 즉시 처리가 곤란한 경우는 회원에게 그 사유와 처리일정을 통보하여야
합니다.
제 11 조 (회원의 의무)
① 이용자는 회원가입 신청 또는 회원정보 변경 시 실명으로 모든 사항을 사실에 근거하여 작성하여야 하며,
허위 또는 타인의 정보를 등록할 경우 일체의 권리를 주장할 수 없습니다.
② 당 사이트가 관계법령 및 개인정보 보호정책에 의거하여 그 책임을 지는 경우를 제외하고 회원에게 부여된
ID의 비밀번호 관리소홀, 부정사용에 의하여 발생하는 모든 결과에 대한 책임은 회원에게 있습니다.
③ 회원은 당 사이트 및 제 3자의 지적 재산권을 침해해서는 안 됩니다.
제 4 장 서비스의 이용
제 12 조 (서비스 이용 시간)
① 서비스 이용은 당 사이트의 업무상 또는 기술상 특별한 지장이 없는 한 연중무휴, 1일 24시간 운영을
원칙으로 합니다. 단, 당 사이트는 시스템 정기점검, 증설 및 교체를 위해 당 사이트가 정한 날이나 시간에
서비스를 일시 중단할 수 있으며, 예정되어 있는 작업으로 인한 서비스 일시중단은 당 사이트 홈페이지를
통해 사전에 공지합니다.
② 당 사이트는 서비스를 특정범위로 분할하여 각 범위별로 이용가능시간을 별도로 지정할 수 있습니다. 다만
이 경우 그 내용을 공지합니다.
제 13 조 (홈페이지 저작권)
① NDSL에서 제공하는 모든 저작물의 저작권은 원저작자에게 있으며, KISTI는 복제/배포/전송권을 확보하고
있습니다.
② NDSL에서 제공하는 콘텐츠를 상업적 및 기타 영리목적으로 복제/배포/전송할 경우 사전에 KISTI의 허락을
받아야 합니다.
③ NDSL에서 제공하는 콘텐츠를 보도, 비평, 교육, 연구 등을 위하여 정당한 범위 안에서 공정한 관행에
합치되게 인용할 수 있습니다.
④ NDSL에서 제공하는 콘텐츠를 무단 복제, 전송, 배포 기타 저작권법에 위반되는 방법으로 이용할 경우
저작권법 제136조에 따라 5년 이하의 징역 또는 5천만 원 이하의 벌금에 처해질 수 있습니다.
제 14 조 (유료서비스)
① 당 사이트 및 협력기관이 정한 유료서비스(원문복사 등)는 별도로 정해진 바에 따르며, 변경사항은 시행 전에
당 사이트 홈페이지를 통하여 회원에게 공지합니다.
② 유료서비스를 이용하려는 회원은 정해진 요금체계에 따라 요금을 납부해야 합니다.
제 5 장 계약 해지 및 이용 제한
제 15 조 (계약 해지)
회원이 이용계약을 해지하고자 하는 때에는 [가입해지] 메뉴를 이용해 직접 해지해야 합니다.
제 16 조 (서비스 이용제한)
① 당 사이트는 회원이 서비스 이용내용에 있어서 본 약관 제 11조 내용을 위반하거나, 다음 각 호에 해당하는
경우 서비스 이용을 제한할 수 있습니다.
- 2년 이상 서비스를 이용한 적이 없는 경우
- 기타 정상적인 서비스 운영에 방해가 될 경우
② 상기 이용제한 규정에 따라 서비스를 이용하는 회원에게 서비스 이용에 대하여 별도 공지 없이 서비스 이용의
일시정지, 이용계약 해지 할 수 있습니다.
제 17 조 (전자우편주소 수집 금지)
회원은 전자우편주소 추출기 등을 이용하여 전자우편주소를 수집 또는 제3자에게 제공할 수 없습니다.
제 6 장 손해배상 및 기타사항
제 18 조 (손해배상)
당 사이트는 무료로 제공되는 서비스와 관련하여 회원에게 어떠한 손해가 발생하더라도 당 사이트가 고의 또는 과실로 인한 손해발생을 제외하고는 이에 대하여 책임을 부담하지 아니합니다.
제 19 조 (관할 법원)
서비스 이용으로 발생한 분쟁에 대해 소송이 제기되는 경우 민사 소송법상의 관할 법원에 제기합니다.
[부 칙]
1. (시행일) 이 약관은 2016년 9월 5일부터 적용되며, 종전 약관은 본 약관으로 대체되며, 개정된 약관의 적용일 이전 가입자도 개정된 약관의 적용을 받습니다.