• 미생물학회지
• /
• 제24권3호
• /
• pp.204-210
• /
• 1986

One clone(pANt32) carring tRNA/sup Arg/ gene was selected from Aspergillus total tRNA gene clones. The nucleotide sequences of this tRNA gene were determined by Maxam and Gilbert's chemical cleavage methods. The sequence of this tRNA gene is as follow; 5'GGCCGGCTGCCCAATTGGCAAGGCGTCTGACTACGAATCAGGAGAT TGCAGGTTCGAGCCCTGCGTGGGTCA3'. This sequence conicides with the characteristecs of other eukaryotic tRNA. Some consensus sequences (ACT-TA bow, TATTTT and T-cluster) are found in both 5'-end and 3'-end flanking regions.

• Journal of Microbiology and Biotechnology
• /
• 제11권2호
• /
• pp.251-258
• /
• 2001

In Gram(+) bacteria and organelles in higher eukarotes, $Gln-tRNA^{Gln}$ utilized for protein biosynthesis is formed by a tRNA-dependent amino acid transformation using mischarged $Gln-tRNA^{Gln}$ as the intermediate. In this study, the gatCAB gene encoding $Gln-tRNA^{Gln}$ amidotransferase (Glu-AdT) of Staphylococcus aureus was cloned and its nucleotide sequence wa determined. The S. aureus gatCAB gene was organized in an operon structure consisting of three open reading frames (gatC, gatA, and gatB), similar to that of Bacillus subtilis. The gene sequences for the A and B subunits of$Gln-tRNA^{Gln}$ amidotransferase showed significant homology (77 and 87% homology with amino acid sequence) with the gatA and gatB genes of B. subtilis, yet the C subunit (gatC) showed a relatively lowe homology with the B. subtilis gatC gene and other orthologues. The cloned S. aureus <$Gln-tRNA^{Gln}$ amidotransferase gene was highly expressed in Escherichia coli, and the resulting crude enzyme could convert misacylated <$Gln-tRNA^{Gln}$ into $Gln-tRNA^{Gln}$ in vitro.

• Animal cells and systems
• /
• 제4권1호
• /
• pp.31-37
• /
• 2000

The genetic variations among six species of Rana from Korea (R. nigro-maculata, R. piancyi, R. dybowskii, R. sp, R. rugosa type A, B and R. amurensis) were investigated using 499 bases of mitochondrial DNA sequences for ND2 (NADH dehydrogenase subunit 2) gene and $tRNA^{Trp}$ gene. Partial sequences of ND2 gene (427 bp) and full sequences of $tRNA^{Trp}$ gene (73 bp) were identified. The level of sequence divergences ranged from 0.2 to 5.2% within species and 4.9-28.0% among 6 species of the genus Rana. The $tRNA^{Trp}$ gene of the genus Rana was composed of 77 nucleotides which showed a two dimensional "cloverleaf" structure. The secondary structure of $tRNA^{Trp}$ was not found compensatory changes which could potentially confound phylogenetic inference. In the neighborjoining tree, brown frogs were clustered first with the level of sequence divergence of 13.20% between R. amurensis and R. dybowskii, and 9% between R. dybowskii and R. sp. supported by 99% bootstrap iterations, respectively. R. nigromaculata and R. plancyi were clustered into another group with 5.1% divergence supported by 100% bootstrap iteration. R. rugosa A 8nd B types were grouped by 4.9% divergence and clustered into the last group with other two groups with 100% bootstrap iterations.

• 대한화학회지
• /
• 제26권6호
• /
• pp.396-402
• /
• 1982

RNase Ⅲ, RNase E, 및 RNase P가 각각 홀로 또는 복합적으로 결핍되는 E. coli 돌연변이 균주들 내에서의 박테리오파지 T4 tRNA의 전구 RNA로 부터의 합성을 연구하였다. RNase E$^-$균주에서는 9S RNA로 볼 수 있는 한 RNA 띠가 축적되었으며 RNase$ P^-$균주에서는 6S 이중띠의 하부띠가 축적되었다. RNase Ⅲ$^-$균주에서는 T4 tRNA 유전인자 떼(cluster)에 의하여 코드되는 (coded) tRNA$^{Gln}$의 생성이 심하게 억제되며 T4 DNA에 의하여는 코드되지만 T4 tRNA 유전인자 떼에 의하여 코드 되는 6S 이중 띠의 상부 띠는 RNase Ⅲ$^+$균주의 경우에 비하여 더 크게 축적된다. 그러나 6S 이중 띠의 상부 띠 RNA와 tRNA$^{Gln}$ 사이에는 precursor-product 관계가 없다고 판단되며 RNase Ⅲ이 precursor RNA을 가수분해 절단 한다고 생각하는 개념을 지지할만한 근거가 없음을 지적할 수 있다.

• 미생물학회지
• /
• 제27권3호
• /
• pp.176-180
• /
• 1989

E. coli의 $tRNA^{phe}$내에는 세 개의 psiudouridine 염기들이 존재한다. 이 $tRNA^{phe}$내의 pseudouridine 염기들의 기능을 연구하기 위하여 부위특이적 돌연변이를 이용하여 $tRNA^{phe}$ 유전자의 염기를 다른 염기로 치환시켰다. E. coli $tRNA^{phe}$ 유전자들 중 하나인 phe W 유전자내에서 32번에 해당하는 T 염기를 C 염기로 39번 T 염기를 C 염기로 Kunkel이 개발한 부위특이적 돌연변이 방법을 사용하여 각각 치환시켰다. DNA 염기서열을 결정함으로써 돌연변이체를 확인하였으며, 이들 돌연변이 유전자를 함유한 재조합 플라스미드를 이용하여 돌연변이된 phe W 유전자들의 E. Coli NP37($pheS^{-ts}$)에 대한 complementation 활성을 조사하였다. 32번 위치가 변이된 pheW 유전자 뿐만아니라 39번 위치가 변이된 phe W 유전자를 함유한 E. coh NP37들은 모두 non-permissive temperature에서 자라지 못하였다. 이 결과는 변이된 pheW 유전자들이 E. coli NP37을 complementation 할 수 없으며, 또 pseudouridine 염기들이 생체내에서 E. coli $tRNA^{phe}$의 활성에 필수적이라는 것을 의미한다.

• Journal of Microbiology and Biotechnology
• /
• 제22권2호
• /
• pp.190-198
• /
• 2012

RNA interference (RNAi) is rapidly becoming a valuable tool in biological studies, as it allows the selective and transient knockdown of protein expression. The short-interfering RNAs (siRNAs) transiently silence gene expression. By contrast, the expressed short-hairpin RNAs induce long-term, stable knockdown of their target gene. Trichoplusia ni (T. ni) cells are widely used for mammalian cell-derived glycoprotein expression using the baculovirus system. However, a suitable shRNA expression system has not been developed yet. We investigated the potency of shRNA-mediated gene expression inhibition using human and Drosophila U6 promoters in T. ni cells. Luciferase, EGFP, and ${\beta}$-N-acetylglucosaminidase (GlcNAcase) were employed as targets to investigate knockdown of specific genes in T. ni cells. Introduction of the shRNA expression vector under the control of human U6 or Drosophila U6 promoter into T. ni cells exhibited the reduced level of luciferase, EGFP, and ${\beta}$-N-acetylglucosaminidase compared with that of untransfected cells. The shRNA was expressed and processed to siRNA in our vector-transfected T. ni cells. GlcNAcase mRNA levels were down-regulated in T. ni cells transfected with shRNA vectors-targeted GlcNAcase as compared with the control vector-treated cells. It implied that our shRNA expression vectors using human and Drosophila U6 promoters were applied in T. ni cells for the specific gene knockdown.

• IMMUNE NETWORK
• /
• 제22권5호
• /
• pp.39.1-39.18
• /
• 2022

RNA metabolism plays a central role in regulating of T cell-mediated immunity. RNA processing, modifications, and regulations of RNA decay influence the tight and rapid regulation of gene expression during T cell phase transition. Thymic selection, quiescence maintenance, activation, differentiation, and effector functions of T cells are dependent on selective RNA modulations. Recent technical improvements have unveiled the complex crosstalk between RNAs and T cells. Moreover, resting T cells contain large amounts of untranslated mRNAs, implying that the regulation of RNA metabolism might be a key step in controlling gene expression. Considering the immunological significance of T cells for disease treatment, an understanding of RNA metabolism in T cells could provide new directions in harnessing T cells for therapeutic implications.

• 미생물학회지
• /
• 제27권4호
• /
• pp.317-322
• /
• 1989

A gene can be selectively overexpressed in E. coli by utilizing the phage T7 RNA polymerase's stringent recognition and active transcription of the T7 promoter. The T7 expression system was constructed such that the T7 RNA polymerase gene is under the control of lacUV5 promoter in one plasmid, and that the target gene, the promoterless chloramphenicol acetyltransferase (CAT) gene with E. coli ribosome binding site is under the control of T7 promoter in the other plasmid. Only the E. coli cells containing both plasmids show high resistance to chloramphenicol. When the copy number of the runaway plasmid containing the polymerase gene was varied by a temperature shift, amounts of the CAT protein synthesized upon induction was correspondingly changed as shown in SDS gel electrophoresis.

• 생명과학회지
• /
• 제18권11호
• /
• pp.1600-1605
• /
• 2008

본 연구는 에스트로겐 생성효소 유전자인 아로마테이즈 유전자의 siRNA를 이용하여 지방전구세포인 3T3-L1 세포의 지방세포 분화 시 나타나는 유전자의 발현을 검증하기 위하여 수행하였다. 먼저, CYP19A1 (aromatase)의 유전자로부터 siRNA를 3쌍을 디자인하고 이를 지방세포의 전구세포인 3T3-L1세포에 유전자 전이 한 후 분화 유도를 통하여 지방세포 생성의 메커니즘을 분석하였다. 결과적으로 비만의 원인 유전자인 렙틴 유전자의 발현 억제를 유도할 수 있었으며 특이적으로 인슐린과의 연관성이 매우 높음을 밝혀 낼 수 있었다. 그리고 비만 또는 백색지방 생성 시 발현이 억제되는 adiponectin과 adipsin의 과발현을 관찰할 수 있었다. 이 결과를 통하여 지방생성의 모든 신호전달체계 중 특정 한 물질을 저해 하므로써 큰 부작용 없이 비만의 문제가 되는 지방생성을 일정 정도 제어 할 수 있음을 확인 할 수 있었다. 그러므로 이 결과는 앞으로 에스트로겐 결핍 또는 과발현에 의하여 문제가 되는 지방생성 메커니즘을 밝히는 연구에 중요한 단서가 될 것으로 기대된다.

• Parasites, Hosts and Diseases
• /
• 제51권4호
• /
• pp.401-412
• /
• 2013

Because of an increased number of Acanthamoeba keratitis (AK) along with associated disease burdens, medical professionals have become more aware of this pathogen in recent years. In this study, by analyzing both the nuclear 18S small subunit ribosomal RNA (18S rRNA) and mitochondrial 16S rRNA gene loci, 27 clinical Acanthamoeba strains that caused AK in Japan were classified into 3 genotypes, T3 (3 strains), T4 (23 strains), and T5 (one strain). Most haplotypes were identical to the reference haplotypes reported from all over the world, and thus no specificity of the haplotype distribution in Japan was found. The T4 sub-genotype analysis using the 16S rRNA gene locus also revealed a clear subconformation within the T4 cluster, and lead to the recognition of a new sub-genotype T4i, in addition to the previously reported sub-genotypes T4a-T4h. Furthermore, 9 out of 23 strains in the T4 genotype were identified to a specific haplotype (AF479533), which seems to be a causal haplotype of AK. While heterozygous nuclear haplotypes were observed from 2 strains, the mitochondrial haplotypes were homozygous as T4 genotype in the both strains, and suggested a possibility of nuclear hybridization (mating reproduction) between different strains in Acanthamoeba. The nuclear 18S rRNA gene and mitochondrial 16S rRNA gene loci of Acanthamoeba spp. possess different unique characteristics usable for the genotyping analyses, and those specific features could contribute to the establishment of molecular taxonomy for the species complex of Acanthamoeba.