• Korean Journal of Microbiology
• /
• v.24 no.3
• /
• pp.204-210
• /
• 1986

One clone(pANt32) carring tRNA/sup Arg/ gene was selected from Aspergillus total tRNA gene clones. The nucleotide sequences of this tRNA gene were determined by Maxam and Gilbert's chemical cleavage methods. The sequence of this tRNA gene is as follow; 5'GGCCGGCTGCCCAATTGGCAAGGCGTCTGACTACGAATCAGGAGAT TGCAGGTTCGAGCCCTGCGTGGGTCA3'. This sequence conicides with the characteristecs of other eukaryotic tRNA. Some consensus sequences (ACT-TA bow, TATTTT and T-cluster) are found in both 5'-end and 3'-end flanking regions.

• Journal of Microbiology and Biotechnology
• /
• v.11 no.2
• /
• pp.251-258
• /
• 2001

In Gram(+) bacteria and organelles in higher eukarotes, $Gln-tRNA^{Gln}$ utilized for protein biosynthesis is formed by a tRNA-dependent amino acid transformation using mischarged $Gln-tRNA^{Gln}$ as the intermediate. In this study, the gatCAB gene encoding $Gln-tRNA^{Gln}$ amidotransferase (Glu-AdT) of Staphylococcus aureus was cloned and its nucleotide sequence wa determined. The S. aureus gatCAB gene was organized in an operon structure consisting of three open reading frames (gatC, gatA, and gatB), similar to that of Bacillus subtilis. The gene sequences for the A and B subunits of$Gln-tRNA^{Gln}$ amidotransferase showed significant homology (77 and 87% homology with amino acid sequence) with the gatA and gatB genes of B. subtilis, yet the C subunit (gatC) showed a relatively lowe homology with the B. subtilis gatC gene and other orthologues. The cloned S. aureus <$Gln-tRNA^{Gln}$ amidotransferase gene was highly expressed in Escherichia coli, and the resulting crude enzyme could convert misacylated <$Gln-tRNA^{Gln}$ into $Gln-tRNA^{Gln}$ in vitro.

• Animal cells and systems
• /
• v.4 no.1
• /
• pp.31-37
• /
• 2000

The genetic variations among six species of Rana from Korea (R. nigro-maculata, R. piancyi, R. dybowskii, R. sp, R. rugosa type A, B and R. amurensis) were investigated using 499 bases of mitochondrial DNA sequences for ND2 (NADH dehydrogenase subunit 2) gene and $tRNA^{Trp}$ gene. Partial sequences of ND2 gene (427 bp) and full sequences of $tRNA^{Trp}$ gene (73 bp) were identified. The level of sequence divergences ranged from 0.2 to 5.2% within species and 4.9-28.0% among 6 species of the genus Rana. The $tRNA^{Trp}$ gene of the genus Rana was composed of 77 nucleotides which showed a two dimensional "cloverleaf" structure. The secondary structure of $tRNA^{Trp}$ was not found compensatory changes which could potentially confound phylogenetic inference. In the neighborjoining tree, brown frogs were clustered first with the level of sequence divergence of 13.20% between R. amurensis and R. dybowskii, and 9% between R. dybowskii and R. sp. supported by 99% bootstrap iterations, respectively. R. nigromaculata and R. plancyi were clustered into another group with 5.1% divergence supported by 100% bootstrap iteration. R. rugosa A 8nd B types were grouped by 4.9% divergence and clustered into the last group with other two groups with 100% bootstrap iterations.

• Journal of the Korean Chemical Society
• /
• v.26 no.6
• /
• pp.396-402
• /
• 1982

Bacteriophage T4 tRNA processing in E. coli mutant strains defective in RNase Ⅲ, RNase E$^-$, and RNase P, respectively, singly or in combinations, was investigated. In $RNase E^- strains, a RNA band, which would be referred as 9S RNA, accumulates, while in RNase$ P^-$ strains, lower band of 6S double band is accumulated. In RNase III$^-$ strains, the production of tRAN$^{Gln}$ coded by T4 tRNA gene cluster, is severely depressed and also production of species 1 RNA, which is coded by T4 DNA but not by the tRNA gene cluster, is in somewhat depressed amounts; on the other hand, at the same time, an upper band of 6S double bands, coded by T4 tRNA gene cluster, is accumulated in rather greater amounts as compared to the RNase $^+$ strain. The upper band RNA of the 6S double band, however, does not appear to be a precursor to the tRNA$^{Gln}$. The present work points to the lack of evidence for an essential cleavage role of RNase Ⅲ, although there must be a role for the RNase Ⅲ in the T4 tRNA processing.

• Korean Journal of Microbiology
• /
• v.27 no.3
• /
• pp.176-180
• /
• 1989

There are three pseudourdine ($Psi$)bases in the E. coli $tRNA^{phe}$ In order to study the function of the pseudouridine bases in the $tRNA^{phe}$, changes of bases $tRNA^{phe}$ gene to other bases were undertaken by the site-specific mutagenesis. Site-specific mutagenesis of T in the pheW gene, a $tRNA^{phe}$ gene of E. coli, corresponding to the baseat the No.32 position to C and also T corresponding to the base at the No.39 position to C were performed using Kunkel's uracil-containing template method. Identification of mutants were undertaken by the KNA sequencing techniques of the mutated pheW genes and activities of the mutated pheW genes complementing to E. coli NP37 mutant($pheS^{-ts}$) using the recombinant plasmid containing the mutated genes. Neither NP37 harboring pheW gene mutated at No.32 position nor NP37 harboring pheW gene mutated at No.39 position can be grown at non-permissive temperature. The result means that both mutated pheW genes can not complement to E. coli NP37, and that the pseudouridine bases are essential to the activity of the E. coli $tRNA^{phe}$ in vivo.

• Journal of Microbiology and Biotechnology
• /
• v.22 no.2
• /
• pp.190-198
• /
• 2012

RNA interference (RNAi) is rapidly becoming a valuable tool in biological studies, as it allows the selective and transient knockdown of protein expression. The short-interfering RNAs (siRNAs) transiently silence gene expression. By contrast, the expressed short-hairpin RNAs induce long-term, stable knockdown of their target gene. Trichoplusia ni (T. ni) cells are widely used for mammalian cell-derived glycoprotein expression using the baculovirus system. However, a suitable shRNA expression system has not been developed yet. We investigated the potency of shRNA-mediated gene expression inhibition using human and Drosophila U6 promoters in T. ni cells. Luciferase, EGFP, and ${\beta}$-N-acetylglucosaminidase (GlcNAcase) were employed as targets to investigate knockdown of specific genes in T. ni cells. Introduction of the shRNA expression vector under the control of human U6 or Drosophila U6 promoter into T. ni cells exhibited the reduced level of luciferase, EGFP, and ${\beta}$-N-acetylglucosaminidase compared with that of untransfected cells. The shRNA was expressed and processed to siRNA in our vector-transfected T. ni cells. GlcNAcase mRNA levels were down-regulated in T. ni cells transfected with shRNA vectors-targeted GlcNAcase as compared with the control vector-treated cells. It implied that our shRNA expression vectors using human and Drosophila U6 promoters were applied in T. ni cells for the specific gene knockdown.

• IMMUNE NETWORK
• /
• v.22 no.5
• /
• pp.39.1-39.18
• /
• 2022

RNA metabolism plays a central role in regulating of T cell-mediated immunity. RNA processing, modifications, and regulations of RNA decay influence the tight and rapid regulation of gene expression during T cell phase transition. Thymic selection, quiescence maintenance, activation, differentiation, and effector functions of T cells are dependent on selective RNA modulations. Recent technical improvements have unveiled the complex crosstalk between RNAs and T cells. Moreover, resting T cells contain large amounts of untranslated mRNAs, implying that the regulation of RNA metabolism might be a key step in controlling gene expression. Considering the immunological significance of T cells for disease treatment, an understanding of RNA metabolism in T cells could provide new directions in harnessing T cells for therapeutic implications.

• Korean Journal of Microbiology
• /
• v.27 no.4
• /
• pp.317-322
• /
• 1989

A gene can be selectively overexpressed in E. coli by utilizing the phage T7 RNA polymerase's stringent recognition and active transcription of the T7 promoter. The T7 expression system was constructed such that the T7 RNA polymerase gene is under the control of lacUV5 promoter in one plasmid, and that the target gene, the promoterless chloramphenicol acetyltransferase (CAT) gene with E. coli ribosome binding site is under the control of T7 promoter in the other plasmid. Only the E. coli cells containing both plasmids show high resistance to chloramphenicol. When the copy number of the runaway plasmid containing the polymerase gene was varied by a temperature shift, amounts of the CAT protein synthesized upon induction was correspondingly changed as shown in SDS gel electrophoresis.

• Journal of Life Science
• /
• v.18 no.11
• /
• pp.1600-1605
• /
• 2008

This study was performed to verify the gene expression of 3T3-L1 using the siRNA of the aromatase gene, which is the estrogen synthesis enzymes. First of all three pairs of siRNA were designed from the CYP19A1 (aromatase) and analyzed the formation of fat cell mechanism by transferring gene to 3T3-L1 and differentiating it. As a result, the expression of leptin gene, which is the main gene causing the obesity, was controlled and the cause of the obesity is related with the insulin specifically. The overexpression of adiponectin and adipsin was observed. This result showed that the formation of the fat was controlled a little without any side effect by obstructing a specific material out of all the signal systems in the fat formation. This study will be an important clue to make it clear that the lack or overexpression of estrogen might be the cause of fat formation mechanism.

• Parasites, Hosts and Diseases
• /
• v.51 no.4
• /
• pp.401-412
• /
• 2013

Because of an increased number of Acanthamoeba keratitis (AK) along with associated disease burdens, medical professionals have become more aware of this pathogen in recent years. In this study, by analyzing both the nuclear 18S small subunit ribosomal RNA (18S rRNA) and mitochondrial 16S rRNA gene loci, 27 clinical Acanthamoeba strains that caused AK in Japan were classified into 3 genotypes, T3 (3 strains), T4 (23 strains), and T5 (one strain). Most haplotypes were identical to the reference haplotypes reported from all over the world, and thus no specificity of the haplotype distribution in Japan was found. The T4 sub-genotype analysis using the 16S rRNA gene locus also revealed a clear subconformation within the T4 cluster, and lead to the recognition of a new sub-genotype T4i, in addition to the previously reported sub-genotypes T4a-T4h. Furthermore, 9 out of 23 strains in the T4 genotype were identified to a specific haplotype (AF479533), which seems to be a causal haplotype of AK. While heterozygous nuclear haplotypes were observed from 2 strains, the mitochondrial haplotypes were homozygous as T4 genotype in the both strains, and suggested a possibility of nuclear hybridization (mating reproduction) between different strains in Acanthamoeba. The nuclear 18S rRNA gene and mitochondrial 16S rRNA gene loci of Acanthamoeba spp. possess different unique characteristics usable for the genotyping analyses, and those specific features could contribute to the establishment of molecular taxonomy for the species complex of Acanthamoeba.