• Proceedings of the Korean Society of Plant Pathology Conference
• /
• 2003.10a
• /
• pp.65.2-65
• /
• 2003

To protect the plant against several soil-borne pathogens, we are currently constructing disease-resistant transgenic root stock for the growth of cucurbitaceae vegetable plants, watermelon and gourd. We made a watermelon cDNA library from Cladosporium cucumerinum-Infected leaves for substractive hybriazation and differential screening. We isolated the several pathogen inducible cDNA clones, such as caffeoyl-CoA-methyltransferase, LAA induced protein, receptor-like kinase homolog, hydroxyproline-rich glycoprotein, catalase, calmodulin binding protein, mitochondrial ATPase beta subunit, methyl tRNA synthetase and WRKY transcription factors. We previously obtained CaMADS in pepper and galactinol synthase ( CsGolS) in cucumber that were confirmed to be related with disease-resistance. CaMADS and CsGolS2 were transformed into the inbred line 'GO701-2' gourd, the inbred line '6-2-2' watermelon and the Kong-dye watermelon by Agrobacterium tumerfaciens LBA4404. Plant growth regulators (zeatin, BAP and IAA) were used for shoot regeneration and root induction for optimal condition. Putative transgenic plants were selected in medium containing 100mg/L kanamycin and integration of the CaMADS and CsGO/S2 into the genomic DNA were demonstrated by the PCR analysis. We isolated major soil-borne pathogens, such as Monosporascus cannonballus, Didymella bryoniae, Cladosporium cuvumerinum from the cultivation area of watermelon or root stock, and successfully established artificial inoculation method for each pathogen. This work was supported by a grant from BioGreen 21 program, Rural Development Administration, Republic of Korea.

• The Plant Pathology Journal
• /
• v.30 no.4
• /
• pp.432-436
• /
• 2014

The soil-borne ascomycete fungus Cylindrocarpon destructans causes ginseng root rot disease and produces various secondary metabolites such as brefeldin A and radicicol. The slow growth of this fungus compared with other plant pathogenic and saprophytic fungi in soil disturbs isolation of this fungus from soil and infected ginseng. In this study, we developed a selective medium for C. destructans using radicicol produced by this fungus. Supplementing 50 mg/L of radicicol to medium inhibited the mycelia growth of other fungi including Botrytis cinerea, Rhizoctonia solani and Alternaria panax, but did not affect the growth of C. destructans. In addition, conidia germination of other fungal species except for C. destructans was inhibited in submerged culture supplemented with radicicol. This medium provides a very efficient tool for isolating C. destructans and also can be used as an enrichment medium for this fungus.

• The Plant Pathology Journal
• /
• v.16 no.3
• /
• pp.156-161
• /
• 2000

A wilt disease occurred on greenhouse-grown eggplants at Yeojoo, Korea in 1997. The wilted eggplants had leaves with gradual yellowing, interveinal necrosis, and marginal crinkling. Vascular tissues of diseased stems were discolored, turned black, and microsclerotia developed at the base of stems. The disease progressed from lower parts of the plants upward. Fungal isolates from discolored vascular tissues were initially whitish to cream color on potato-dextrose agar (PDA) plate, which later turned black due to the formation of microsclerotia. Conidiophores were erect, hyaline, verticillately branched, and had 3 or 4 phialides arising at each node. Phialides were hyaline, arranged in whorls, and measured as 17.5-32.5 x 2-3$\mu\textrm{m}$. Conidia were hyaline, ellipsoidal to sub-cylindrical, mainly one-celled, and measured as 5-8.8 x 2-4$\mu\textrm{m}$. Conidia were borne in small clusters at the tips of phialides. Microsclerotia formed on PDA plates, and consisted of globular cells that formed irregular masses of various shapes. Chlamydospores were absent. Based on these cultural and morphological characteristics, the fungus was identified as Verticillium dahliae Klebahn. Pathogenicity tests by root cutting, root dipping or soil drenching resulted in similar symptoms observed in the naturally infected eggplants. This is the first report on occurrence of Verticillium wilt of eggplant in Korea.

• Mycobiology
• /
• v.51 no.4
• /
• pp.195-209
• /
• 2023

The seed borne disease such as bakanae is difficult to control. Crop yield loss caused by bakanae depending on the regions and varieties grown, ranging from 3.0% to 95.4%. Bakanae is an important disease of rice worldwide and the pathogen was identified as Fusarium fujikuroi Nirenberg (teleomorph: Gibberella fujikuroi Sawada). Currently, four Fusaria (F. fujikuroi, F. proliferatum, F. verticillioides and F. andiyazi) belonging to F. fujikuroi species complex are generally known as the pathogens of bakanae. The infection occurs through both seed and soil-borne transmission. When infection occurs during the heading stage, rice seeds become contaminated. Molecular detection of pathogens of bakanae is important because identification based on morphological and biological characters could lead to incorrect species designation and time-consuming. Seed disinfection has been studied for a long time in Korea for the management of the bakanae disease of rice. As seed disinfectants have been studied to control bakanae, resistance studies to chemicals have been also conducted. Presently biological control and resistant varieties are not widely used. The detection of this pathogen is critical for seed certification and for preventing field infections. In South Korea, bakanae is designated as a regulated pathogen. To provide highly qualified rice seeds to farms, Korea Seed & Variety Service (KSVS) has been producing and distributing certified rice seeds for producing healthy rice in fields. Therefore, the objective of the study is to summarize the recent progress in molecular identification, fungicide resistance, and the management strategy of bakanae.

• Journal of Microbiology
• /
• v.39 no.1
• /
• pp.56-61
• /
• 2001

Plasmodiophora brassicae is an obligate parasite, a causal organism of clubroot disease in crucifers that can survive in the soil as resting spores for many years. P. brassicae causes great losses in susceptible varieties of crucifers throughout the world. In this present study, an in planta molecular marker for the detection of P. bassicae was developed using an oligonucleotide primer set foam the small subunit gene (18S like) and internal transcribed spacer (ITS) region of rDNA. The specific primer sequences determined were TCAGCTTGAATGCTAATGTG (ITS5) and CTACCTCATTTGAGATCCTTTGA (PB-2). This primer set was used to specifically detect p. bassicae in planta. The amplicon using the specific primer set was about 1,000 bp. However, the test plant and other soil-borne fungi including Fusarium spp. and Rhizoctonia app., as well as bacteria such as Pseudomonas app. and Erwinia sup. did not show any reaction with the primer set.

• Research in Plant Disease
• /
• v.11 no.1
• /
• pp.48-55
• /
• 2005

Cylindrocarpon destructans is a soil-borne plant pathogenic fungus causing root rot on ginseng and trees. Rapid and exact detection of this pathogen was practiced on ginseng seedlings by nested PCR using speciesspecific primer set. The second round of PCR amplification by Dest 1 and Dest 4 primer set formed 400 bp of species-specific fragment of C. destructans from the product of first round of amplification by ITS 1 and ITS 4 primer set. In the PCR sensitivity test based on DNA density, nested PCR detected to the limit of one fg and it meant the nested PCR could detect up to a few spores of C. destructans. Also, nested PCR made it possible to detect the pathogen from ginseng seedlings infected by replantation on artificial infested soil. Our nested PCR results using species-specific primer set could be utilized for diagnosis of root rot disease in ginseng cultivation.

• Horticultural Science & Technology
• /
• v.30 no.4
• /
• pp.442-448
• /
• 2012

Many outbreaks of food-borne illnesses have been associated with the consumption of fresh vegetables and fruits contaminated with food-borne pathogens. Contaminated medium, manure and irrigation water are probable vehicles for the pathogen in many outbreaks. The aim of this study was to determine the potential transfer of Escherichia coli and Bacillus cereus from medium and soil fertilized with contaminated compost or irrigation with contaminated water to the edible parts of lettuce. Moreover, survivals of the two pathogens on lettuce contaminated medium, soil and irrigation water were estimated. Lettuce seeds were planted in medium contaminated with 7.5 log colony forming unit (CFU)/g of E. coli and B. cereus. Seedlings grown in the contaminated medium were transplanted in soil fertilized with contaminated pig manure compost or uncontaminated soil. Contaminated irrigation water with E. coli and B. cereus at 8.0 log CFU/mL was applied only once on the plant by sprinkle irrigation and surface irrigation. Although E. coli and B. cereus in medium and sprouted lettuce after planting seeds were reduced as time passed, these pathogens survived in seedling raising stage for extended periods. The numbers of E. coli and B. cereus in lettuce grown on contaminated soil were detected over 4.0 log CFU/g for 21 days. The numbers of E. coli and B. cereus in lettuce applied by sprinkle irrigation were higher than those of surface irrigation by 5.0 log CFU/g. Our results indicated that contaminated medium, soil and irrigation water can play an important role in the presence of food-borne pathogens on vegetables.

• Korean Journal of Environmental Biology
• /
• v.40 no.4
• /
• pp.398-404
• /
• 2022

Bis(2-ethylhexyl) phthalate (DEHP) is one of the plasticizers used in the polyvinyl chloride(PVC) industry. It is known to be easily released into the environment. In this study, we investigated effects of DEHP on growth, metabolic pathway, and virulence gene expression in soil-borne bacterial plant pathogen, Pectobacterium carotovorum SCC1 using in vitro assays. As a result, DEHP at 20 ㎍ mL^-1 did not affect the growth, cell membrane permeability, or ATPase activity of P. carotovorum SCC1. However, it decreased succinyl-CoA synthase (SCS) activity in the tricarboxylic acid (TCA) cycle. Relative expression levels of virulence genes encoding pectate lyase and pectin were differentially influenced by DEHP treatment. These results suggest that biological characteristics of P. carotovorum might be influenced by DEHP in soil.

• The Plant Pathology Journal
• /
• v.19 no.3
• /
• pp.184-187
• /
• 2003

Verticillium wilt was first observed in 2001 on potatoes (Solanum tuberosum) cv. Superior at Daegwallyong area, one of the major seed potato producing areas in Korea. The wilted potato plants showed typical symptoms including gradual yellowing and interveinal necrosis. There was discoloration in the vascular tissues of the infected stems which turned light brown. Fungal isolates from discolored vascular tissues were whitish to creamy with folding on potato dextrose agar medium, where they used to produce resting dark mycelia but no micro-sclerotia. Conidiophores were septate with side branches, swelled at the base, and arranged in a whorl. Conidia were 2.5-11.2$\times$2.0-4.5 $\mu\textrm{m}$ um in size and were borne in small clusters at the tips of phialides. Optimal temperature range for mycelial growth was $25-30^{\circ}C$. Based on these cultural and morphological characteristics, the fungus was identified as Verticillium albo-atrum Reink & Berth. Pathogenicity tests by root dipping method revealed that the fungus caused the same symptoms as observed in naturally infected potato plants. This is the first report of Verticillium wilt on potato caused by Verticillium albo-atrum in Korea.

• Microbiology and Biotechnology Letters
• /
• v.20 no.3
• /
• pp.263-270
• /
• 1992

For the selection of powerful antagonistic bacterium for biological control of soil borne Eminia carotovora subsp. carotovora causing rot of vegetable, excellent strains (S4, S14, 565) were selected from 1,196 strains of bacteria which were isolated from rhizosphere in vegetable root rot-suppresive soil. Strains were identified to be Pseudomonas species with Api 20NE kit. Antagonistic substance was produced in 523 synthetic broth medium at pH 7~8 and $30^{\circ}C$ during 3 days culture. The substance was stable in the pH range of 6 to 9. When the basal medium was supplemented with mannitol and sorbitol as carbon source and calcium chloride as metal salt, the production of the inhibitory substance was increased. The inhibitory acitivity was increased by the addition of fertilizer in soil. The isolated strains were resistant to the agricultural chemical such as benomyl and fosethyl-Al-folpet, and the antibiotics such as penicillin and lincomycin. We had found that Pseudomonas sp. S14 strain had a single plasmid. After treated with acridin orange for curing, we confirmed the existence of antagonistic gene in the chromosomal DNA.