• 제목/요약/키워드: s-sequences

검색결과 2,936건 처리시간 0.029초

Generation of Finite Inductive, Pseudo Random, Binary Sequences

  • Fisher, Paul;Aljohani, Nawaf;Baek, Jinsuk
    • Journal of Information Processing Systems
    • /
    • 제13권6호
    • /
    • pp.1554-1574
    • /
    • 2017
  • This paper introduces a new type of determining factor for Pseudo Random Strings (PRS). This classification depends upon a mathematical property called Finite Induction (FI). FI is similar to a Markov Model in that it presents a model of the sequence under consideration and determines the generating rules for this sequence. If these rules obey certain criteria, then we call the sequence generating these rules FI a PRS. We also consider the relationship of these kinds of PRS's to Good/deBruijn graphs and Linear Feedback Shift Registers (LFSR). We show that binary sequences from these special graphs have the FI property. We also show how such FI PRS's can be generated without consideration of the Hamiltonian cycles of the Good/deBruijn graphs. The FI PRS's also have maximum Shannon entropy, while sequences from LFSR's do not, nor are such sequences FI random.

Nucleotide sequence analysis of the 5S ribosomal RNA gene of the mushroom tricholoma matsutake

  • Hwang, Seon-Kap;Kim, Jong-Guk
    • Journal of Microbiology
    • /
    • 제33권2호
    • /
    • pp.136-141
    • /
    • 1995
  • From a cluster of structural rRNA genes which has previsouly been cloned (Hwang and Kim, in submission; J. Microbiol. Biotechnol.), a 1.0-kb Eco RI fragment of DNA which shows significant homology to the 25S and rRNA s of Tricholoma matsutake was used for sequence analysis. Nucleotide sequence was bidirectionally determined using delection series of the DNA fragment. Comparing the resultant 1016-base sequence with sequences in the database, both the 3'end of 25S-rRNA gene and 5S rRNA gene were searched. The 5S rRNA gene is 118-bp in length and is located 158-bp downstream of 3'end of the 25S rRNA gene. IGSI and IGS2 (partial) sequences are also contained in the fragment. Multiple alignment of the 5S rRNA sequences was carried out with 5S rRNA sequences from some members of the subdivision Basidiomycotina obtained from the database. Polygenetic analysis with distance matrix established by Kimura's 2-parameter method and phylogenetic tree by UPGMA method proposed that T. matsutake is closely related to efibulobasidium allbescens. Secondary structure of 5S rRNA was also hypothesized to show similar topology with its generally accepted eukaryotic counterpart.

  • PDF

Patome: Database of Patented Bio-sequences

  • Kim, SeonKyu;Lee, ByungWook
    • Genomics & Informatics
    • /
    • 제3권3호
    • /
    • pp.94-97
    • /
    • 2005
  • We have built a database server called Patome which contains the annotation information for patented bio-sequences from the Korean Intellectual Property Office (KIPO). The aims of the Patome are to annotate Korean patent bio-sequences and to provide information on patent relationship of public database entries. The patent sequences were annotated with Reference Sequence (RefSeq) or NCBI's nr database. The raw patent data and the annotated data were stored in the database. Annotation information can be used to determine whether a particular RefSeq ID or NCBI's nr ID is related to Korean patent. Patome infrastructure consists of three components­the database itself, a sequence data loader, and an online database query interface. The database can be queried using submission number, organism, title, applicant name, or accession number. Patome can be accessed at http://www.patome.net. The information will be updated every two months.

상호상관 함숫값이 4개인 이진수열의 새로운 데시메이션 (New Decimations of Binary Sequences with 4-Valued Cross-Correlations)

  • 권숙희;조성진;권민정;김한두;최언숙;김진경
    • 한국정보통신학회논문지
    • /
    • 제17권3호
    • /
    • pp.627-633
    • /
    • 2013
  • 무선이동통신 시스템에서 두 수열의 상호상관 함숫값은 통화 품질과 사용자 수를 결정하는데 있어 큰 영향을 끼치고 있다. 본 논문에서는 주기 $2^n-1$인 m-수열에 새로운 데시메이션 $d=\frac{2^{m-st-1}}{2^s-1}(2^n+2^{st+s+1}-2^{m+st+1}-1)$를 적용하여 또 다른 m-수열을 생성하고 두 수열의 상호상관 함숫값과 그 값들의 발생횟수를 결정한다.

Intrageneric Relationships of Trichoderma Based on Internal Transcribed Spacers and 5.8S rDNA Nucleotide Sequences

  • Kim, Gi-Young;Lee, Goang-Jae;Ha, Myung-Gyu;Lee, Tae-Ho;Lee, Jae-Dong
    • Mycobiology
    • /
    • 제28권1호
    • /
    • pp.11-16
    • /
    • 2000
  • The nucleotide sequences of the internal transcribed spacer (ITS) regions of the ribosomal DNA including the 5.8S ribosomal RNA gene (rDNA) have been determined for 11 species in order to analyze their intrageneric relationships. The total length of these sequences ranged from 530 nucleotides for Trichoderma reesei KCTC 1286 to 553 nucleotide for Trichoderma koningii IAM 12534. Generally speaking, the length of ITS1 region was about 30 nucleotides longer than that of the ITS2 region. Also, the sequences of 5.8S rDNA were more conserved in length and variation than those of ITS regions. Although the variable ITS sequences were often ambiguously aligned, the conserved sites were also found. Thus, a neighbor-joining tree was constructed using the full sequence data of the ITS regions and the 5.8S rDNA. The Trichoderma genus used to be grouped on the basis of the morphological features and especially the shape of phialides needs to be reexamined. The phylogenetic tree displayed the presence of monophylogeny in the species of Trichoderma. Therefore, it was difficult to distinguish the intrageneric relationships in the Trichoderma genus.

  • PDF

5-값 상호상관관계를 갖는 새로운 비선형 이진수열군의 설계와 선형스팬 분석 (Design and Analysis of Linear Span of A New Family of Non-linear Binary Sequences with 5-Valued Cross-Correlation Functions)

  • 최언숙;조성진;김한두
    • 한국정보통신학회논문지
    • /
    • 제17권3호
    • /
    • pp.619-626
    • /
    • 2013
  • 여러 가지 디지털통신 시스템에서 많이 사용되고 있는 의사 난수열을 설계하는데 있어 가장 중요한 문제는 생성된 수열들 사이의 상호상관관계가 낮은 수열을 생성하는 것이다. 본 논문에서는 Gold 계열의 수열의 합성으로 이루어지는 새로운 이진수열군 $S^r=\{Tr_1^m\{[Tr_m^n(a{\alpha}^t+{\alpha}^{dt})]^r\}{\mid}a{\in}GF(2^n),\;0{\leq}t<2^n-1\}$를 제안하고 $d=2^{n-1}(3{\cdot}2^m-1)$일 때 상호상관관계 함숫값을 구한다. 여기서 n=2m이고 gcd(r, $2^m-1$)=1이다. 또한 특별한 r에 대하여 이진수열군 $S^r$의 선형스팬을 분석한다. 제안된 수열은 Gold 계열 수열의 확장이기도 하고 GMW수열의 확장이기도 하다.

동충하초의 계통분류 및 시판동충하초의 분류학적 위치 (Phylogenetic Analysis of the Entomopathogenic Fungal Species and Taxonomical Positions of Their Commercial Products)

  • 김순한;이영자;김인복;김미경;한정아;홍무기;이순호;이재동
    • 생명과학회지
    • /
    • 제13권4호
    • /
    • pp.400-411
    • /
    • 2003
  • 5.8S rDNA를 포함한 ITS부위에 대한 염기서열 분석결과, 종에 따라 다양한 염기서열을 가지고 있어 분류에 이용될 수 있었으며, 특히 ITS2부위보다 ITS1부위에서 종에 대한 변이율이 높은 것으로 나타났다. 아울러 균종에 따라 정도의 차이는 있으나 사용된 모든 종들이 서로 계통분류학적 거리가 멀어서 종간의 구분이 명확하게 나타났다. P. tenuipes, I. japonica, P. japonicus는 multiple alignment분석에서 매우 유사한 염기서열을 가지고 있어, 이들 세종은 같은 종이지만 다른 이름으로 불리고 있는 것으로 나타났으며, 아울러 Paecilomyces sp. KACC 40220과 KACC 40656도 동일한 염기서열을 가지고 있어 p. tenuipes로 판단된다. 국내에서 유통되는 동충하초제품 35건과 중국산 1건에 대해 실험한 결과 23건은 P. tenuipes / japonica로, 11건은 C. militaris로, 1건은 B. bassiana로 분류되었으며, 중국산 제품 1건은 C. multiaxialis로 분류되었다.

Genetic Diversity and Molecular Phylogeny of Cyanobacteria from Sri Lanka Based on 16S rRNA Gene

  • Wanigatunge, R.P.;Magana-Arachchi, D.N.;Chandrasekharan, N.V.;Kulasooriya, S.A.
    • Environmental Engineering Research
    • /
    • 제19권4호
    • /
    • pp.317-329
    • /
    • 2014
  • The diversity of cyanobacteria in Sri Lanka was studied in different water reservoirs, paddy fields, brackish water and tsunami affected areas using light microcopy, 16S rRNA sequences, followed by phylogenetic analysis. Based on light microscopy, 24 genera were identified from environmental samples belonging to the orders Chroococcales, Oscillatoriales, Pleurocapsales and Nostocales. In cultures, 33 genera were identified from all five cyanobacterial orders, including Stigonematales. Based on 16S rRNA gene sequences and their morphology, two isolates were identified up to species level, 72 to genus level, one isolate up to family and 11 up to order level. Twelve isolates couldn't be assigned to any taxonomic level. The results of 16S rRNA gene sequences along with the phylogenetic analysis indicated that some cyanobacterial isolates could be accommodated to genus or order level. The 16S rRNA sequence analysis data in this study confirmed that order Nostocales and order Pleurocapsales cyanobacteria are monophyletic while orders Chroococcales, Oscillatoriales and Stigonematales cyanobacteria are polyphyletic. Polyphasic approach including the combination of light microscopy, cultures and the analysis of 16S rRNA gene sequences provide a promising approach to ascertain the diversity of cyanobacteria in different habitats.

The Phylogenetic Affiliation of an Uncultured Population of Ammonia-Oxidizing Bacteria Harboring Environmental Sequences of amoA Cluster-3

  • Hong, Jin-Kyung;Cho, Jae-Chang
    • Journal of Microbiology and Biotechnology
    • /
    • 제21권6호
    • /
    • pp.567-573
    • /
    • 2011
  • We investigated the phylogenetic diversity of ammoniaoxidizing bacteria (AOB) in Yellow Sea continental shelf sediment by the cloning and sequencing of PCR-amplified amoA and 16S rRNA genes. Phylogenetic analysis of the amoA-related clones revealed that the diversity of AOB was extremely low at the study site. The majority (92.7%) of amoA clones obtained belonged to a single cluster, environmental amoA cluster-3, the taxonomic position of which was previously unknown. Phylogenetic analysis on AOB-specific 16S rRNA gene sequences also demonstrated a very low diversity. All of the cloned 16S rRNA gene sequences comprised a single phylotype that belonged to the members of uncultured Nitrosospira cluster-1, suggesting that AOB belonging to the uncultured Nitrosospira cluster-1 could carry amoA sequences of environmental amoA cluster-3.

Aspergillus nidulans의 tRNA 유전자의 구조와 발현에 관한 연구 VI

  • 이병재;강현삼
    • 미생물학회지
    • /
    • 제24권3호
    • /
    • pp.204-210
    • /
    • 1986
  • One clone(pANt32) carring tRNA/sup Arg/ gene was selected from Aspergillus total tRNA gene clones. The nucleotide sequences of this tRNA gene were determined by Maxam and Gilbert's chemical cleavage methods. The sequence of this tRNA gene is as follow; 5'GGCCGGCTGCCCAATTGGCAAGGCGTCTGACTACGAATCAGGAGAT TGCAGGTTCGAGCCCTGCGTGGGTCA3'. This sequence conicides with the characteristecs of other eukaryotic tRNA. Some consensus sequences (ACT-TA bow, TATTTT and T-cluster) are found in both 5'-end and 3'-end flanking regions.

  • PDF