This paper introduces a new type of determining factor for Pseudo Random Strings (PRS). This classification depends upon a mathematical property called Finite Induction (FI). FI is similar to a Markov Model in that it presents a model of the sequence under consideration and determines the generating rules for this sequence. If these rules obey certain criteria, then we call the sequence generating these rules FI a PRS. We also consider the relationship of these kinds of PRS's to Good/deBruijn graphs and Linear Feedback Shift Registers (LFSR). We show that binary sequences from these special graphs have the FI property. We also show how such FI PRS's can be generated without consideration of the Hamiltonian cycles of the Good/deBruijn graphs. The FI PRS's also have maximum Shannon entropy, while sequences from LFSR's do not, nor are such sequences FI random.
From a cluster of structural rRNA genes which has previsouly been cloned (Hwang and Kim, in submission; J. Microbiol. Biotechnol.), a 1.0-kb Eco RI fragment of DNA which shows significant homology to the 25S and rRNA s of Tricholoma matsutake was used for sequence analysis. Nucleotide sequence was bidirectionally determined using delection series of the DNA fragment. Comparing the resultant 1016-base sequence with sequences in the database, both the 3'end of 25S-rRNA gene and 5S rRNA gene were searched. The 5S rRNA gene is 118-bp in length and is located 158-bp downstream of 3'end of the 25S rRNA gene. IGSI and IGS2 (partial) sequences are also contained in the fragment. Multiple alignment of the 5S rRNA sequences was carried out with 5S rRNA sequences from some members of the subdivision Basidiomycotina obtained from the database. Polygenetic analysis with distance matrix established by Kimura's 2-parameter method and phylogenetic tree by UPGMA method proposed that T. matsutake is closely related to efibulobasidium allbescens. Secondary structure of 5S rRNA was also hypothesized to show similar topology with its generally accepted eukaryotic counterpart.
We have built a database server called Patome which contains the annotation information for patented bio-sequences from the Korean Intellectual Property Office (KIPO). The aims of the Patome are to annotate Korean patent bio-sequences and to provide information on patent relationship of public database entries. The patent sequences were annotated with Reference Sequence (RefSeq) or NCBI's nr database. The raw patent data and the annotated data were stored in the database. Annotation information can be used to determine whether a particular RefSeq ID or NCBI's nr ID is related to Korean patent. Patome infrastructure consists of three componentsthe database itself, a sequence data loader, and an online database query interface. The database can be queried using submission number, organism, title, applicant name, or accession number. Patome can be accessed at http://www.patome.net. The information will be updated every two months.
무선이동통신 시스템에서 두 수열의 상호상관 함숫값은 통화 품질과 사용자 수를 결정하는데 있어 큰 영향을 끼치고 있다. 본 논문에서는 주기 $2^n-1$인 m-수열에 새로운 데시메이션 $d=\frac{2^{m-st-1}}{2^s-1}(2^n+2^{st+s+1}-2^{m+st+1}-1)$를 적용하여 또 다른 m-수열을 생성하고 두 수열의 상호상관 함숫값과 그 값들의 발생횟수를 결정한다.
Kim, Gi-Young;Lee, Goang-Jae;Ha, Myung-Gyu;Lee, Tae-Ho;Lee, Jae-Dong
Mycobiology
/
제28권1호
/
pp.11-16
/
2000
The nucleotide sequences of the internal transcribed spacer (ITS) regions of the ribosomal DNA including the 5.8S ribosomal RNA gene (rDNA) have been determined for 11 species in order to analyze their intrageneric relationships. The total length of these sequences ranged from 530 nucleotides for Trichoderma reesei KCTC 1286 to 553 nucleotide for Trichoderma koningii IAM 12534. Generally speaking, the length of ITS1 region was about 30 nucleotides longer than that of the ITS2 region. Also, the sequences of 5.8S rDNA were more conserved in length and variation than those of ITS regions. Although the variable ITS sequences were often ambiguously aligned, the conserved sites were also found. Thus, a neighbor-joining tree was constructed using the full sequence data of the ITS regions and the 5.8S rDNA. The Trichoderma genus used to be grouped on the basis of the morphological features and especially the shape of phialides needs to be reexamined. The phylogenetic tree displayed the presence of monophylogeny in the species of Trichoderma. Therefore, it was difficult to distinguish the intrageneric relationships in the Trichoderma genus.
여러 가지 디지털통신 시스템에서 많이 사용되고 있는 의사 난수열을 설계하는데 있어 가장 중요한 문제는 생성된 수열들 사이의 상호상관관계가 낮은 수열을 생성하는 것이다. 본 논문에서는 Gold 계열의 수열의 합성으로 이루어지는 새로운 이진수열군 $S^r=\{Tr_1^m\{[Tr_m^n(a{\alpha}^t+{\alpha}^{dt})]^r\}{\mid}a{\in}GF(2^n),\;0{\leq}t<2^n-1\}$를 제안하고 $d=2^{n-1}(3{\cdot}2^m-1)$일 때 상호상관관계 함숫값을 구한다. 여기서 n=2m이고 gcd(r, $2^m-1$)=1이다. 또한 특별한 r에 대하여 이진수열군 $S^r$의 선형스팬을 분석한다. 제안된 수열은 Gold 계열 수열의 확장이기도 하고 GMW수열의 확장이기도 하다.
5.8S rDNA를 포함한 ITS부위에 대한 염기서열 분석결과, 종에 따라 다양한 염기서열을 가지고 있어 분류에 이용될 수 있었으며, 특히 ITS2부위보다 ITS1부위에서 종에 대한 변이율이 높은 것으로 나타났다. 아울러 균종에 따라 정도의 차이는 있으나 사용된 모든 종들이 서로 계통분류학적 거리가 멀어서 종간의 구분이 명확하게 나타났다. P. tenuipes, I. japonica, P. japonicus는 multiple alignment분석에서 매우 유사한 염기서열을 가지고 있어, 이들 세종은 같은 종이지만 다른 이름으로 불리고 있는 것으로 나타났으며, 아울러 Paecilomyces sp. KACC 40220과 KACC 40656도 동일한 염기서열을 가지고 있어 p. tenuipes로 판단된다. 국내에서 유통되는 동충하초제품 35건과 중국산 1건에 대해 실험한 결과 23건은 P. tenuipes / japonica로, 11건은 C. militaris로, 1건은 B. bassiana로 분류되었으며, 중국산 제품 1건은 C. multiaxialis로 분류되었다.
The diversity of cyanobacteria in Sri Lanka was studied in different water reservoirs, paddy fields, brackish water and tsunami affected areas using light microcopy, 16S rRNA sequences, followed by phylogenetic analysis. Based on light microscopy, 24 genera were identified from environmental samples belonging to the orders Chroococcales, Oscillatoriales, Pleurocapsales and Nostocales. In cultures, 33 genera were identified from all five cyanobacterial orders, including Stigonematales. Based on 16S rRNA gene sequences and their morphology, two isolates were identified up to species level, 72 to genus level, one isolate up to family and 11 up to order level. Twelve isolates couldn't be assigned to any taxonomic level. The results of 16S rRNA gene sequences along with the phylogenetic analysis indicated that some cyanobacterial isolates could be accommodated to genus or order level. The 16S rRNA sequence analysis data in this study confirmed that order Nostocales and order Pleurocapsales cyanobacteria are monophyletic while orders Chroococcales, Oscillatoriales and Stigonematales cyanobacteria are polyphyletic. Polyphasic approach including the combination of light microscopy, cultures and the analysis of 16S rRNA gene sequences provide a promising approach to ascertain the diversity of cyanobacteria in different habitats.
We investigated the phylogenetic diversity of ammoniaoxidizing bacteria (AOB) in Yellow Sea continental shelf sediment by the cloning and sequencing of PCR-amplified amoA and 16S rRNA genes. Phylogenetic analysis of the amoA-related clones revealed that the diversity of AOB was extremely low at the study site. The majority (92.7%) of amoA clones obtained belonged to a single cluster, environmental amoA cluster-3, the taxonomic position of which was previously unknown. Phylogenetic analysis on AOB-specific 16S rRNA gene sequences also demonstrated a very low diversity. All of the cloned 16S rRNA gene sequences comprised a single phylotype that belonged to the members of uncultured Nitrosospira cluster-1, suggesting that AOB belonging to the uncultured Nitrosospira cluster-1 could carry amoA sequences of environmental amoA cluster-3.
One clone(pANt32) carring tRNA/sup Arg/ gene was selected from Aspergillus total tRNA gene clones. The nucleotide sequences of this tRNA gene were determined by Maxam and Gilbert's chemical cleavage methods. The sequence of this tRNA gene is as follow; 5'GGCCGGCTGCCCAATTGGCAAGGCGTCTGACTACGAATCAGGAGAT TGCAGGTTCGAGCCCTGCGTGGGTCA3'. This sequence conicides with the characteristecs of other eukaryotic tRNA. Some consensus sequences (ACT-TA bow, TATTTT and T-cluster) are found in both 5'-end and 3'-end flanking regions.
본 웹사이트에 게시된 이메일 주소가 전자우편 수집 프로그램이나
그 밖의 기술적 장치를 이용하여 무단으로 수집되는 것을 거부하며,
이를 위반시 정보통신망법에 의해 형사 처벌됨을 유념하시기 바랍니다.
[게시일 2004년 10월 1일]
이용약관
제 1 장 총칙
제 1 조 (목적)
이 이용약관은 KoreaScience 홈페이지(이하 “당 사이트”)에서 제공하는 인터넷 서비스(이하 '서비스')의 가입조건 및 이용에 관한 제반 사항과 기타 필요한 사항을 구체적으로 규정함을 목적으로 합니다.
제 2 조 (용어의 정의)
① "이용자"라 함은 당 사이트에 접속하여 이 약관에 따라 당 사이트가 제공하는 서비스를 받는 회원 및 비회원을
말합니다.
② "회원"이라 함은 서비스를 이용하기 위하여 당 사이트에 개인정보를 제공하여 아이디(ID)와 비밀번호를 부여
받은 자를 말합니다.
③ "회원 아이디(ID)"라 함은 회원의 식별 및 서비스 이용을 위하여 자신이 선정한 문자 및 숫자의 조합을
말합니다.
④ "비밀번호(패스워드)"라 함은 회원이 자신의 비밀보호를 위하여 선정한 문자 및 숫자의 조합을 말합니다.
제 3 조 (이용약관의 효력 및 변경)
① 이 약관은 당 사이트에 게시하거나 기타의 방법으로 회원에게 공지함으로써 효력이 발생합니다.
② 당 사이트는 이 약관을 개정할 경우에 적용일자 및 개정사유를 명시하여 현행 약관과 함께 당 사이트의
초기화면에 그 적용일자 7일 이전부터 적용일자 전일까지 공지합니다. 다만, 회원에게 불리하게 약관내용을
변경하는 경우에는 최소한 30일 이상의 사전 유예기간을 두고 공지합니다. 이 경우 당 사이트는 개정 전
내용과 개정 후 내용을 명확하게 비교하여 이용자가 알기 쉽도록 표시합니다.
제 4 조(약관 외 준칙)
① 이 약관은 당 사이트가 제공하는 서비스에 관한 이용안내와 함께 적용됩니다.
② 이 약관에 명시되지 아니한 사항은 관계법령의 규정이 적용됩니다.
제 2 장 이용계약의 체결
제 5 조 (이용계약의 성립 등)
① 이용계약은 이용고객이 당 사이트가 정한 약관에 「동의합니다」를 선택하고, 당 사이트가 정한
온라인신청양식을 작성하여 서비스 이용을 신청한 후, 당 사이트가 이를 승낙함으로써 성립합니다.
② 제1항의 승낙은 당 사이트가 제공하는 과학기술정보검색, 맞춤정보, 서지정보 등 다른 서비스의 이용승낙을
포함합니다.
제 6 조 (회원가입)
서비스를 이용하고자 하는 고객은 당 사이트에서 정한 회원가입양식에 개인정보를 기재하여 가입을 하여야 합니다.
제 7 조 (개인정보의 보호 및 사용)
당 사이트는 관계법령이 정하는 바에 따라 회원 등록정보를 포함한 회원의 개인정보를 보호하기 위해 노력합니다. 회원 개인정보의 보호 및 사용에 대해서는 관련법령 및 당 사이트의 개인정보 보호정책이 적용됩니다.
제 8 조 (이용 신청의 승낙과 제한)
① 당 사이트는 제6조의 규정에 의한 이용신청고객에 대하여 서비스 이용을 승낙합니다.
② 당 사이트는 아래사항에 해당하는 경우에 대해서 승낙하지 아니 합니다.
- 이용계약 신청서의 내용을 허위로 기재한 경우
- 기타 규정한 제반사항을 위반하며 신청하는 경우
제 9 조 (회원 ID 부여 및 변경 등)
① 당 사이트는 이용고객에 대하여 약관에 정하는 바에 따라 자신이 선정한 회원 ID를 부여합니다.
② 회원 ID는 원칙적으로 변경이 불가하며 부득이한 사유로 인하여 변경 하고자 하는 경우에는 해당 ID를
해지하고 재가입해야 합니다.
③ 기타 회원 개인정보 관리 및 변경 등에 관한 사항은 서비스별 안내에 정하는 바에 의합니다.
제 3 장 계약 당사자의 의무
제 10 조 (KISTI의 의무)
① 당 사이트는 이용고객이 희망한 서비스 제공 개시일에 특별한 사정이 없는 한 서비스를 이용할 수 있도록
하여야 합니다.
② 당 사이트는 개인정보 보호를 위해 보안시스템을 구축하며 개인정보 보호정책을 공시하고 준수합니다.
③ 당 사이트는 회원으로부터 제기되는 의견이나 불만이 정당하다고 객관적으로 인정될 경우에는 적절한 절차를
거쳐 즉시 처리하여야 합니다. 다만, 즉시 처리가 곤란한 경우는 회원에게 그 사유와 처리일정을 통보하여야
합니다.
제 11 조 (회원의 의무)
① 이용자는 회원가입 신청 또는 회원정보 변경 시 실명으로 모든 사항을 사실에 근거하여 작성하여야 하며,
허위 또는 타인의 정보를 등록할 경우 일체의 권리를 주장할 수 없습니다.
② 당 사이트가 관계법령 및 개인정보 보호정책에 의거하여 그 책임을 지는 경우를 제외하고 회원에게 부여된
ID의 비밀번호 관리소홀, 부정사용에 의하여 발생하는 모든 결과에 대한 책임은 회원에게 있습니다.
③ 회원은 당 사이트 및 제 3자의 지적 재산권을 침해해서는 안 됩니다.
제 4 장 서비스의 이용
제 12 조 (서비스 이용 시간)
① 서비스 이용은 당 사이트의 업무상 또는 기술상 특별한 지장이 없는 한 연중무휴, 1일 24시간 운영을
원칙으로 합니다. 단, 당 사이트는 시스템 정기점검, 증설 및 교체를 위해 당 사이트가 정한 날이나 시간에
서비스를 일시 중단할 수 있으며, 예정되어 있는 작업으로 인한 서비스 일시중단은 당 사이트 홈페이지를
통해 사전에 공지합니다.
② 당 사이트는 서비스를 특정범위로 분할하여 각 범위별로 이용가능시간을 별도로 지정할 수 있습니다. 다만
이 경우 그 내용을 공지합니다.
제 13 조 (홈페이지 저작권)
① NDSL에서 제공하는 모든 저작물의 저작권은 원저작자에게 있으며, KISTI는 복제/배포/전송권을 확보하고
있습니다.
② NDSL에서 제공하는 콘텐츠를 상업적 및 기타 영리목적으로 복제/배포/전송할 경우 사전에 KISTI의 허락을
받아야 합니다.
③ NDSL에서 제공하는 콘텐츠를 보도, 비평, 교육, 연구 등을 위하여 정당한 범위 안에서 공정한 관행에
합치되게 인용할 수 있습니다.
④ NDSL에서 제공하는 콘텐츠를 무단 복제, 전송, 배포 기타 저작권법에 위반되는 방법으로 이용할 경우
저작권법 제136조에 따라 5년 이하의 징역 또는 5천만 원 이하의 벌금에 처해질 수 있습니다.
제 14 조 (유료서비스)
① 당 사이트 및 협력기관이 정한 유료서비스(원문복사 등)는 별도로 정해진 바에 따르며, 변경사항은 시행 전에
당 사이트 홈페이지를 통하여 회원에게 공지합니다.
② 유료서비스를 이용하려는 회원은 정해진 요금체계에 따라 요금을 납부해야 합니다.
제 5 장 계약 해지 및 이용 제한
제 15 조 (계약 해지)
회원이 이용계약을 해지하고자 하는 때에는 [가입해지] 메뉴를 이용해 직접 해지해야 합니다.
제 16 조 (서비스 이용제한)
① 당 사이트는 회원이 서비스 이용내용에 있어서 본 약관 제 11조 내용을 위반하거나, 다음 각 호에 해당하는
경우 서비스 이용을 제한할 수 있습니다.
- 2년 이상 서비스를 이용한 적이 없는 경우
- 기타 정상적인 서비스 운영에 방해가 될 경우
② 상기 이용제한 규정에 따라 서비스를 이용하는 회원에게 서비스 이용에 대하여 별도 공지 없이 서비스 이용의
일시정지, 이용계약 해지 할 수 있습니다.
제 17 조 (전자우편주소 수집 금지)
회원은 전자우편주소 추출기 등을 이용하여 전자우편주소를 수집 또는 제3자에게 제공할 수 없습니다.
제 6 장 손해배상 및 기타사항
제 18 조 (손해배상)
당 사이트는 무료로 제공되는 서비스와 관련하여 회원에게 어떠한 손해가 발생하더라도 당 사이트가 고의 또는 과실로 인한 손해발생을 제외하고는 이에 대하여 책임을 부담하지 아니합니다.
제 19 조 (관할 법원)
서비스 이용으로 발생한 분쟁에 대해 소송이 제기되는 경우 민사 소송법상의 관할 법원에 제기합니다.
[부 칙]
1. (시행일) 이 약관은 2016년 9월 5일부터 적용되며, 종전 약관은 본 약관으로 대체되며, 개정된 약관의 적용일 이전 가입자도 개정된 약관의 적용을 받습니다.