• 한국식품위생안전성학회지
• /
• 제27권3호
• /
• pp.317-324
• /
• 2012

본 연구는 식품원료의 진위여부를 판별하기 위한 시험법으로 일반 프라이머를 이용한 DNA barcode 기법을 도입하였다. 동물성식품원료의 경우 미토콘드리아 DNA 중 cytochrome oxidase subunit I(COI) 부위 검출을 위하여 디자인된 프라이머(LCO1490/HCO2198 및 VF2/FISH R2)와 cytochrome b(cyt b) 부위 검출을 위하여 디자인된 프라이머(L14724/H15915)를 사용하였다. 상기 3 종류의 프라이머를 사용하여 가축류 6종(소, 돼지, 염소, 양, 말 및 사슴), 가금류 4종(닭, 오리, 칠면조 및 타조), 어류 7종(명태, 대구, 청대구, 청어, 송어, 다랑어 및 우럭)을 대상으로 PCR 후 전기영동하여 예상되는 PCR 산물의 생성 유무를 확인하였다. 가축류 6종에 대하여는 LCO1490/HCO2198, VF2/FISH R2 및 L14724/H15915 프라이머를 사용한 경우 COI 및 cyt b가 모두 검출되었으며, 가금류 4종은 LCO1490/HCO2198 및 VF2/FISH R2 프라이머를 사용한 경우만 COI이 검출되었다. 또한 어류 7종은 VF2/FISH R2 프라이머를 사용한 경우에만 COI 부위가 검출됨을 확인하였다. 식물의 경우 엽록체 DNA 부위를 이용하여 디자인된 3 종류의 프라이머(trnH/psbA, rpoB 1F/4R 및 rbcL 1F/724R)를 사용하였다. 각각의 프라이머를 이용하여 식물 5종(마늘, 양파, 무, 녹차 및 시금치)에 대하여 실험한 결과 3종류의 프라이머에서 PCR의 산물을 모두 확인하였으며 trnH/psbA 프라이머의 경우 식물 종마다 PCR 산물의 크기는 다르게 검출되었다. 본 연구에서는 17종의 식품원료별 일반 프라이머 및 PCR 조건을 확립하였으며, 생산된 PCR 산물을 대상으로 염기서열을 결정하고 유전자은행에 있는 염기서열과 DB 비교 분석을 통하여 식품에 사용된 원료의 진위여부 판별에 적용이 가능할 것으로 기대된다.

• 한국자원식물학회지
• /
• 제19권1호
• /
• pp.54-58
• /
• 2006

한국, 중국, 러시아에서 자생하고 있는 가시오갈피에 대한 유전적 유연관계를 파악하기 위해 ITS (internal transcribed spacer)의 염기서열을 분석하였다. Universal primer를 사용하여 PCR로 증폭시킨 후 염기서열을 결정한 결과 ITS의 길이는 162 bp의 5.8S rRNA 유전자를 포함하여 한국산과 중국산은 608 bp 그리고 러시아산은 611 bp로 나타났다. ITS영역의 G+C 함량은 한국산과 중국산이 60.20%이고 러시아산이 60.06%였다. 한국산과 중국산의 ITS영역은 100% 동일하였으며, 러시아산은 한국산과 비교했을 때 3 bp의 염기삽입과 2 bp의 염기치환이 존재하여 99.2%의 상동성을 나타내었다. 따라서 한국산 가시오갈피는 러시아산보다 중국산과 유전적 유연관계가 더 가까운 것으로 추정된다. 또한 동일 속내에서는 오갈피나무보다는 음나무와 ITS 염기서열이 유사한 것으로 나타났다.

• 한국균학회지
• /
• 제41권1호
• /
• pp.47-51
• /
• 2013

국내 자연환경의 효모 균총을 확인함으로써 유용한 효모자원을 확보하기 위한 연구의 일환으로 대전 계족산, 충남 오서산 그리고 전북 백암산 지역에 서식하는 야생화들을 채집하여 이들로부터 효모들을 분리, 동정하였다. 대전의 계족산에서 수집한 야생화로부터는 10종에 속하는 12균주의 효모들을 분리하였고, 충남의 오서산에서 수집한 야생화로부터는 10종의 효모들 17균주를 분리하였다. 또한 전북 백암산의 야생화로부터 모두 24종에 속하는 38균주의 효모들을 분리하였다. 계족산, 오서산, 그리고 백암산에서 모두 발견된 효모는 Cryptococcus 속, Pseudozygoma 속, Rhodotorula 속, Sporobolomyces 속에 속하는 9종의 효모들이었다. 특히 3개 지역에서 수집한 야생화들로부터 Cryptococcus 속에 속하는 Cryptococcus aureus만이 모두 분리되었는데, 이 결과는 각 지역마다 독특한 효모 다양성을 보이고 있음을 시사하는 것이다.

• 한국균학회소식:학술대회논문집
• /
• 한국균학회 2014년도 추계학술대회 및 정기총회
• /
• pp.49-49
• /
• 2014

In order to find indigenous beneficial fungal species from crop field soils of Nigeria, 23 soil samples were collected from various places of Nigeria in June, 2013 and fungi were isolated through serial dilution technique. Isolated fungi were purified and differentiated according to their morphological and microscopic characteristics. In total, 38 different representative isolates were recovered and the genomic DNA of each isolates was extracted using QIAGEN$^{(R)}$ Plasmid Mini Kit (QIAGEN Sciences, USA) and the identification of fungi was carried out by sequence analysis of internal transcribed spacer (ITS) region of the 18S ribosomal DNA (18S rDNA). Recovered isolates belonged to 9 fungal genera comprising Fusarium, Aspergillus, Chaetomium, Coniothyrium, Dipodascaceae, Myrothecium, Neosartorya, Penicillium and Trichoderma. Aspergillus spp., Penicillium spp. and Trichoderma spp. were the most dominant taxa in this study. The antagonistic potentiality of species belonged to Trichoderma against 10 phytopathogenic fungi (F. oxysporum, C. gloesporoides, P. cytrophthora, A. alternata, A. solani, S. rolfsii, F. solani, R. solani, S. sclerotiorum and P. nicotiana) was assessed in vitro using dual culture assay. The dual culture assay results showed varied degree of antagonism against the tested phytopathogens. The potential Trichoderma spp. will be further evaluated for their antagonistic and plant growth promotion potentiality under in vivo conditions.

• 한국균학회지
• /
• 제46권1호
• /
• pp.1-8
• /
• 2018

국내에 보고되지 않은 3종의 균류가 담수환경으로 부터 분리되었다. NNIBRFG108은 강원도 삼척의 담수침전식물체에서 분리되었고, NNIBRFG1139와 NNIBRFG1480은 경북 김천과 제주지역의 토양으로부터 분리되었다. 형태적 특징 및 internal transcribed spacers (ITS), 18S rDNA, 28S rDNA 및 ${\beta}$-tubulin 유전자를 이용한 분자계통학적 분류를 통해 동정한 결과, NNIBRFG108, NNIBRFG1139, NNIBRFG1480 균주는 각각 Didymella segeticola, D. ellipsoidea 및 D. aeria으로 확인되었다. 이는 국내에서는 발견되지 않은 미기록종으로 본 보고가 국내 최초이다.

• Mycobiology
• /
• 제38권2호
• /
• pp.89-96
• /
• 2010

This study evaluated the optimal vegetative growth conditions and molecular phylogenetic relationships of eleven strains of Agrocybe cylindracea collected from different ecological regions of Korea, China and Taiwan. The optimal temperature and pH for mycelial growth were observed at $25^{\circ}C$ and 6. Potato dextrose agar and Hennerberg were the favorable media for vegetative growth, whereas glucose tryptone was unfavorable. Dextrin, maltose, and fructose were the most effective carbon sources. The most suitable nitrogen sources were arginine and glycine, whereas methionine, alanine, histidine, and urea were least effective for the mycelial propagation of A. cylindracea. The internal transcribed spacer (ITS) regions of rDNA were amplified using PCR. The sequence of ITS2 was more variable than that of ITS1, while the 5.8S sequences were identical. The reciprocal homologies of the ITS sequences ranged from 98 to 100%. The strains were also analyzed by random amplification of polymorphic DNA (RAPD) using 20 arbitrary primers. Fifteen primers efficiently amplified the genomic DNA. The average number of polymorphic bands observed per primer was 3.8. The numbers of amplified bands varied based on the primers and strains, with polymorphic fragments ranging from 0.1 to 2.9 kb. The results of RAPD analysis were similar to the ITS region sequences. The results revealed that RAPD and ITS techniques were well suited for detecting the genetic diversity of all A. cylindracea strains tested.

• 한국버섯학회지
• /
• 제10권3호
• /
• pp.143-149
• /
• 2012

수집한 83개의 뽕나무버섯속 균주의 rDNA의 ITS 영역을 증폭하여 염기서열을 분석한 결과 수집한 균주목록과 종이 다르게 동정된 균주가 52%였으며. 같은 종으로 분류한 균주들 간에도 균사 및 균사체의 배양 특성에 많은 차이를 보였다. 수집 균주간의 유전적인 유연관계 분석 결과 A. tabescens, A. mellea, A. novae-zelandia, A. gallica, A. ostoyae 등으로 분류되었고, A. gallica, A, cepistipes, A, gemina는 매우 가까운 유연관계를 보여 ITS 유전자 수준에서 종을 동정하기는 어려웠다. ASI10104 등 12균주는 A. gallica, A, cepistipes, A, gemina와 매우 가까운 유연관계를 보였으며, ASI10017과 ASI10114는 A. sinapina, ASI10045는 A. borealis, ASI10002와 ASI10025는 A. ostoyae와 같은 그룹으로 분류되었다. 따라서 뽕나무버섯속 균주에 대한 보다 정확한 동정을 위해서는 보다 많은 종류의 유전적인 분석이 필요할 것으로 판단된다.

• Journal of Microbiology
• /
• 제39권1호
• /
• pp.56-61
• /
• 2001

Plasmodiophora brassicae is an obligate parasite, a causal organism of clubroot disease in crucifers that can survive in the soil as resting spores for many years. P. brassicae causes great losses in susceptible varieties of crucifers throughout the world. In this present study, an in planta molecular marker for the detection of P. bassicae was developed using an oligonucleotide primer set foam the small subunit gene (18S like) and internal transcribed spacer (ITS) region of rDNA. The specific primer sequences determined were TCAGCTTGAATGCTAATGTG (ITS5) and CTACCTCATTTGAGATCCTTTGA (PB-2). This primer set was used to specifically detect p. bassicae in planta. The amplicon using the specific primer set was about 1,000 bp. However, the test plant and other soil-borne fungi including Fusarium spp. and Rhizoctonia app., as well as bacteria such as Pseudomonas app. and Erwinia sup. did not show any reaction with the primer set.

• 한국균학회지
• /
• 제43권3호
• /
• pp.191-195
• /
• 2015

A new species of Neosartorya was recovered during investigation of the fungal community in soil samples collected from different locations in Korea; Neosartorya aureola KNU14-7 was isolated for the first time from field soil in Korea and identified based on the internal transcribed spacer region of rDNA and morphological characteristics. The species has not been officially reported from Korea and we report it here with description and figures.

• Mycobiology
• /
• 제43권2호
• /
• pp.166-169
• /
• 2015

We report the isolation of a Gongronella butleri species and describe it based on the analysis of the internal transcribed spacer region of rDNA and morphological characteristics. G. butleri has been reported as a high chitosan producer in the literature. This is the first record of G. butleri isolated from crop field soil in Korea.