• The Korean Journal of Mycology
• /
• v.44 no.4
• /
• pp.240-246
• /
• 2016

During a survey of the activities of fungi in steamed sweet potato, stored garlic, agricultural by-products for mushroom cultivation media, and pinewood chips from a pinewood nematode-infected tree, numerous fungal samples were isolated and identified. This study identified five species that have not been previously reported in Korea, namely Geomyces pannorum, Neopestalotiopsis javaensis, Penicillium allii, Penicillium chermesinum, and Ophiognomonia setacea. For all identified species, the cultural features of colonies formed on growth media, their morphological characteristics observed by a light microscope, and their molecular phylogenetic relationships based on nucleotide sequences of the internal transcribed spacer rDNA region or calmodulin gene were described.

• Journal of Microbiology
• /
• v.39 no.1
• /
• pp.56-61
• /
• 2001

Plasmodiophora brassicae is an obligate parasite, a causal organism of clubroot disease in crucifers that can survive in the soil as resting spores for many years. P. brassicae causes great losses in susceptible varieties of crucifers throughout the world. In this present study, an in planta molecular marker for the detection of P. bassicae was developed using an oligonucleotide primer set foam the small subunit gene (18S like) and internal transcribed spacer (ITS) region of rDNA. The specific primer sequences determined were TCAGCTTGAATGCTAATGTG (ITS5) and CTACCTCATTTGAGATCCTTTGA (PB-2). This primer set was used to specifically detect p. bassicae in planta. The amplicon using the specific primer set was about 1,000 bp. However, the test plant and other soil-borne fungi including Fusarium spp. and Rhizoctonia app., as well as bacteria such as Pseudomonas app. and Erwinia sup. did not show any reaction with the primer set.

• Mycobiology
• /
• v.43 no.1
• /
• pp.71-74
• /
• 2015

During a survey of fungal species in South Korea, a species of Volutella ciliata was isolated and described based on the analysis of the internal transcribed spacer region of its rDNA and its morphological characteristics. This is the first record of Volutella ciliata isolated from crop field soil in Korea.

• Journal of Environmental Science International
• /
• v.18 no.12
• /
• pp.1331-1338
• /
• 2009

Marine dinoflagellate Alexandrium minutum producing paralytic shellfish toxins is responsible for paralytic shellfish poisoning (PSP). To investigate its temporal distributions in Chinhae Bay where PSP occurs annually, SYBR Green I based A. minutum-specific real-time PCR probe was developed on the LSU rDNA region. Assay specificity and sensitivity were tested against related species, and its specificity was further confirmed by sequencing of field-derived samples. Ten months field survey in 2008 (a total 100 surface water samples) by using the real-time PCR probe showed that A. minutum was detected at very low densities of 1-4 cells $L^{-1}$ in May and June being spring in Chinhae Bay, Korea.

• The Korean Journal of Mycology
• /
• v.42 no.3
• /
• pp.235-238
• /
• 2014

Oidiodendron flavum KNU13-6 was isolated for the first time from field soil in Korea and identified based on the internal transcribed spacer region (ITS) of rDNA and morphological characteristics. Based on phylogenetic analysis of ITS and morphological characteristics, the species has not been previously reported in Korea.

• Korean Journal of Environmental Biology
• /
• v.40 no.4
• /
• pp.497-509
• /
• 2022

A strain of Amphidinium species was established from samples collected from the intertidal zone of a sandy beach of Jeju Island, Korea. Its cells were 13.0-15.0 ㎛ in length and 10.0-13.0 ㎛ in width. Its cell shape was round or oval and dorsoventrally flat. A pyrenoid was located in the center of the cell and a nucleus was posteriorly located. Its epicone was small and left-deflecting. Its cingulum had V-shape on the ventral side, forming a ventral ridge and extending to the sulcus. Polygonal amphiesmal vesicles and ring-shaped body scales not described previous were observed on the surface of the cell. Its morphological features were consistent with those of previously described Amphidinium fijiense. Phylogeny based on ITS region and LSU rDNA sequences revealed that this Amphidinium isolate was clearly clustered with other A. fijiense strains, but separated from other Amphidinium species. These results indicate that this Amphidinium isolate is A. fijiense. This study reports its presence for the first time in the intertidal zone of a sandy beach of Jeju Island, Korea.

• Asian Pacific Journal of Cancer Prevention
• /
• v.17 no.7
• /
• pp.3191-3193
• /
• 2016

Background: The human papilloma virus (HPV) is considered as the major risk factor for the development of cervical cancer. This virus is of different genotypes and generally can be classified into high and low risk types. Objective: To determine the rate of high risk HPV genotypes in women with vaginal discharge and lower abdominal pain in Kurdistan region, Iraq. Materials and Methods: Cervical swabs were taken from 104 women. DNA was extracted and the polymerase chain reaction (PCR) technique was used to determine the presence of high risk genotypes. Results: It was found that 13/104 (12.5%) of the samples were positive for high risk HPV genotypes. Amongst those who were positive, 4/13 (30.7%) were typed as genotype 16 and 7/13 (53.8%) showed mixed genotyping. On the other hand, genotypes 53 and 56 were found in only one sample each. Conclusions: High risk HPV genotypes are not uncommon and further community based study is needed to determine the prevalence of HPV and its genotypes and plan for prevention of infection.

• The Korean Journal of Mycology
• /
• v.40 no.4
• /
• pp.288-291
• /
• 2012

Korean oak wilt disease caused by Raffaelea quercus-mongolicae is vectored by the ambrosia beetle Platypus koryoensis. To prevent the spread of the disease, the beetle infested oak tree had been cut into logs, covered with plastic vinyl, fumigated with a pesticide, and stored for three years on the site where the tree was cut. This study was carried out to get information on the fungi colonizing the fumigated oak wood. Wood disk samples collected from the fumigated oak logs at two locations in the Taejo Mountain, Cheonan city, were used for fungal isolation. A total of 99 filamentous fungal isolates were obtained from the wood disk samples. Hypocrea spp., Trichoderma spp. and Penicillium spp. were identified based on morphological characteristics and nucleotide sequence analysis of translation elongation factor 1-alpha gene and ITS rDNA region. Trichoderma was the major fungal group. R. quercus-mongolicae, and P. koryoensis were not detected from the fumigated oak wood. Our work provided evidence that after three years of storage, the fumigated oak wilt-diseased logs should be no longer harmful source of oak wilt disease transmission.

• Journal of Microbiology and Biotechnology
• /
• v.12 no.5
• /
• pp.773-779
• /
• 2002

A gene (hap) encoding aminopeptidase from the chromosomal DNA of Bacillus licheniformis was cloned. The gene is 1,347 bp long and encodes a 449 amino acid preproprotein with a major mature region of 401 amino acids (calculated molecular mass 43,241 Da). N-Terminal sequence of the purified protein revealed a potential presence of N-terminal propeptide. The deduced primary amino acid sequence and the mass analysis of the purified protein suggested that a C-terminal peptide YSSVAQ was also cleaved off by a possible endogeneous protease. Tho amino acid sequence displayed 58% identity with that of the aminopeptidase from alkaliphilic Bacillus halodurans. This bacterial enzyme was overexpressed in recombinant Escherichia coli and Bacillus subtilis cells. Clones containing the intact hap gene, including its own promoter and signal sequence, gave rise to the synthesis of extracellular and thrmostable enzyme by B. subtilis transformants. The secreted protein exhibited the same biochemical properties and the similar apparent molecular mass as the B. lichenzyormis original enzyme.

• The Plant Pathology Journal
• /
• v.21 no.3
• /
• pp.262-269
• /
• 2005

An antiviral producing bacterial strain was isolated from a ginseng rhizosphere in Kangwon province of Republic of Korea. In order to identify the bacterial strain, microbiological, physiological and biochemical tests were performed, along with RAPD, 16S rRNA, 16S-23S rRNA ITS (intergenic spacer region) and DNA-DNA hybridization analyses. The bacterium was found to be a strain of Pseudomonas fluorescens, which was designated as Gpf01. The strain was grown in Muller-Hinton (MH) broth, and the culture supernatant obtained was filtered through a $0.45{\mu}l$ filter. It was further boiled at $100^{\circ}C$ and tested in two experiments for its ability to control a yellow strain of Cucumber mosaic virus (CMV-Y). In the first experiment, boiled culture filtrate (RCF) was treated on one half of the leaves of Chenopodium amaranticolor followed by CMV- Y inoculation on both halves. In the second experiment, BCF was treated on the lower leaves of Nicotiana tobacum var. Xanthi-nc, with the CMV-Y mechanically inoculated onto the upper untreated leaves. In the first experiment, BCF treatment was able to considerably reduce the number of viral lesion, and in the second experiment, plants treated with BCF showed no visible viral symptoms compared to the Muller-Hinton (MH) media treated controls 15 days post inoculation (dpi), and remained symptomless throughout the study period. Thus, Gpf01, identified as P. fluorescence, was able to produce an antiviral component in the culture filtrate, which was found to be heat stable, non-phytotoxic and effective in local as well as systemic hosts of CMV.