• IMMUNE NETWORK
• /
• 제8권2호
• /
• pp.59-65
• /
• 2008

Background: Toll-like receptors (TLRs) detect microbial infection and can directly induce innate host defense responses, which are thought to play critical roles in protecting the tubotympanum from infection. However, little is known about the relationship between TLRs, which are related to innate immunity, and immunoglobulins, which are related to adaptive immunity, in recurrent otitis media with effusion (OME). We therefore investigated the expression of TLR2 and TLR4 and immunoglobulin in children with OME. Methods: The study population consisted of 72 children with OME, 31 with more than 4 episodes in 12 months or more than 3 episodes in 6 months (otitis-prone group), and 41 with fewer than 3 episodes in 12 months (non-otitis prone group). The expression in middle ear effusion of TLR2 and TLR4 mRNA, as determined by Real time- -polymerase chain reaction (RT-PCR), and the concentrations of IgG, IgA, and IgM, as determined by Enzyme-linked immunosorbent assay(ELISA), were compared between the two groups. Results: Expression of TLR2 and TLR4 mRNA was lower in the otitis prone than in the non-otitis prone group, but the difference was not statistically significant (p>0.05). Between group differences in the concentrations of IgG, IgA and IgM in effusion fluid were not significant (p>0.05), and there were no correlations between immunoglobulin concentration and the expression of TLR2 and TLR4. Conclusion: Although there was a trend toward lower expression of TLR2 and TLR4 in the otitis-prone group, the differences, and those in immunoglobulin concentration, did not differ significantly between the otitis-prone and non-prone groups.

• Asian Pacific Journal of Cancer Prevention
• /
• 제17권5호
• /
• pp.2435-2438
• /
• 2016

Background: MiRNAs, small non coding RNAs, play a role in the regulation of hematopoiesis, with effects on cell growth, differentiation, and apoptosis. In addition, MiRNAs are thought to play an important role in tumorigenesis. The miR146a G>C polymorphism can lead to alteration of miR146 expression, which appears to be associated with development and progression of several cancers. This study aimed to investigate the association of the miRNA146a (rs2910164) G>C polymorphism and susceptibility to childhood acute lymphoblastic leukemia (ALL) and clinical outcomes. Materials and Methods: Totals of 100 childhood ALL patients and 200 healthy children were studied for miR146a polymorphisms using polymerase chain reaction-restriction fragment-length polymorphism (PCR-RFLP). Results: The frequency of the miR146a G allele in controls was 0.40 compared with 0.38 in ALL patients. There was no association between miRNA146a (rs2910164) G>C polymorphism and susceptibility to childhood ALL (OR=1.484, 95%CI=0.712-3.093, p=0.290). Moreover, the frequencies of miR146a (rs2910164) G>C polymorphism were not associated with demographic data and clinical outcomes in ALL cases. Conclusions: The miRNA146a polymorphism was not significantly associated with susceptibility to Thai childhood ALL or any clinico-pathological variables.

• Asian Pacific Journal of Cancer Prevention
• /
• 제14권12호
• /
• pp.7629-7634
• /
• 2013

Background: Cylin D1(CCDN1) is an important regulator of the cell cycle whose alterations are thought to be involved in cancer development. There have been many studies indicating CCDN1 amplification or over-expression in a variety of cancer types. In addition to gene amplification, the G870A polymorphism may be related with altered CCDN1 activity, and therefore with cancer development. This hypothesis has been tested in different cancer types but results have been contradictory. We therefore aimed to investigate any relationship between CCDN1 A870G genotypes and laryngeal squamous cell cancer development and progression. Materials and Methods: A total of 68 Turkish patients with primary laryngeal squamous cell cancer and 133 healthy controls were enrolled. Polymerase chain reaction-restriction fragment length polymorphism analysis was used to determine the CCDN1 genotypes. Results: No significant association was detected between CCDN1 genotypes and laryngeal squamous cell cancer (LxSCCa) development. Similarly CCDN1 genotypes were not related to clinical parameters of Lx SCCa. However, there was a very significant association between CCDN1 G allele and presence of perineural invasion (p=0.003; OR: 1.464; CI% 1.073-1.999). CCDN1 G allele frequency was significantly higher in the individuals with perineural invasion (85.7%) when compared to those without (58.5%). The 2 patients who died of disease were both found to possess the GG genotype. Conclusions: These results pose a controversy in suggesting a protective role of the G allele against LxSCCa development and support the association of CCDN1 gene GG genotype with mortality in patients with LxSCCa.

• 생물정신의학
• /
• 제11권2호
• /
• pp.88-93
• /
• 2004

Background:Serotonin transporter gene-linked polymorphism region(5-HTTLPR) and catechol-O-methyltransferase( COMT) genes are thought to be important factors in some personality traits and the etiology of anxiety disorder. The goal of this study was to determine the role of these genes in personality traits. Method:The participants included 116 healthy adults with no history of psychiatric disorders and other physical illness for the last 6 months. All participants were tested by Temperament and Character Inventory(TCI). The 5-HTTLPR, COMT val158met gene polymorphisms were analyzed with PCR(Polymerase Chain Reaction). Differences on TCI dimensions and sub-scales among groups were examined with t-test and ANOVA. Result:There were possible relationships of the 5-HTTLPR with self-transcendence(P=0.050) and COMT val158met polymorphism with cooperativeness(P=0.053). Conclusion:We found associations between 5-HTTLPR, COMT polymorphisms and the some TCI character dimensions. Further studies of polymorphisms of other genes and their interactions may clarify the complex relationship between personality and genes.

• IMMUNE NETWORK
• /
• 제2권1호
• /
• pp.25-34
• /
• 2002

Background: Rheumatoid arthritis (RA) is a chronic inflammatory disease characterized by synovial hyperplasia and joint destruction. The synovial fibroblasts express cell adhesion molecules and have a role in adhesive interation with inflammatory cells in synovial tissue. It has been suggested that hypoxic conditioins are thought to exist in arthritic joints, and several studies indicate that reactive oxygen species (ROS) produced in hypoxic condition can initiate events that lead to pro-adhesive changes via increased expression of adhesion molecules. So, this study wsa designed to examine whether antioxidant can inhibit hypoxia-induced expression of ICAM-1 in cultured human synovial fibroblasts. Methods: Synovial fibroblasts were isolated from synovial tissue in patients with RA and cultured at hypoxic condition. Antioxidant, PDTC (pyrrolidine dithiocarbamate) were pre-treated for an hour before the hypoxic culture and synovial fibroblasts were harvested at 0, 6, 12, 24, 48 hours time points. Cell surface ICAM-1 expression in synovial fibroblasts was examined by the flow cytometric analysis. To analyse the expression of ICAM-1 mRNA, reverse-transcriptase polymerase chain reaction (RT-PCR) was performed. The levels of cytokines in culture supernatants were measured by ELISA, and activation of NF-${\kappa}B$ was analysed by electrophoretic mobility shift assay. The adhesive reaction between synovial fibroblasts and lymphocytes was assayed by measurement of fluorescent intensity of BCECF-AM in lymphocytes. Results: Hypoxic stimuli up-regulated the ICAM-1 expression as well as the adhesive interaction of human synvial fibroblasts to lymphocytes in a time-dependent manner, and PDTC inhibited hpyoxia-induced ICAM-1 expression and cell-cell interaction. PDTC also inhibited the hypoxia-induced activation of intracellular transcription factor, NF-${\kappa}B$. PDTC decreased the amount of hypoxia-induced production of IL-$1{\beta}$ and TNF-${\alpha}$. Conclusion: These studies demonstrate that PDTC inhibit the hypoxia-induced expression of the adhesion molecule, ICAM-1 and activation of NF-${\kappa}B$ in cultured human synovial fibroblasts.

• IMMUNE NETWORK
• /
• 제24권1호
• /
• pp.1.1-1.6
• /
• 2024

IL-18 binding protein (IL-18BP) was originally discovered in 1999 while attempting to identify an IL-18 receptor ligand binding chain (also known as IL-18Rα) by subjecting concentrated human urine to an IL-18 ligand affinity column. The IL-18 ligand chromatography purified molecule was analyzed by protein microsequencing. The result revealed a novel 40 amino acid polypeptide. To isolate the complete open reading frame (ORF), various human and mouse cDNA libraries were screened using cDNA probe derived from the novel IL-18 affinity column bound molecule. The identified entire ORF gene was thought to be an IL-18Rα gene. However, IL-18BP has been proven to be a unique soluble antagonist that shares homology with a variety of viral proteins that are distinct from the IL-18Rα and IL-18Rβ chains. The IL-18BP cDNA was used to generate recombinant IL-18BP (rIL-18BP), which was indispensable for characterizing the role of IL-18BP in vitro and in vivo. Mammalian cell lines were used to produce rIL-18BP due to its glycosylation-dependent activity of IL-18BP (approximately 20 kDa). Various forms of rIL-18BP, intact, C-terminal his-tag, and Fc fusion proteins were produced for in vitro and in vivo experiments. Data showed potent neutralization of IL-18 activity, which seems promising for clinical application in immune diseases involving IL-18. However, it was a long journey from discovery to clinical use although there have been various clinical trials since IL-18BP was discovered in 1999. This review primarily covers the discovery of IL-18BP along with how basic research influences the clinical development of IL-18BP.

• 한국응용과학기술학회지
• /
• 제32권3호
• /
• pp.536-545
• /
• 2015

This study aimed to investigate the effect of various emulsifiers on the formation of nanoemulsions and their stability properties. MCT (medium chain triglyceride) nanoemulsions were prepared (10 wt% oil, 10 wt% emulsifiers, 20 mM bis-tris, pH 7) with emulsifier such as Tween 20 (Polyoxyethylene(20) sorbitan monolaurate), Almax 3800 (Sorbitan monooleate), soy lecithin, and SSL (sodium stearoyl lactylate) and changes in fat globule size with respect to storage period and stability properties by Turbiscan were investigated. In case of control nanoemulsion with 10 wt% Tween 20, the initial fat globule size was 89.0 nm and 113.4 nm after 28 day of storage and this large increase (ca. 24 nm) was thought to be caused by Ostwald ripening. When Tween 20 was partially replaced with Almax 3800, lecithin and SSL in nanoemulsions, their physicochemical properties (i.e., fat globule size and stability) were changed accordingly. In general, the intial fat globule size was decreased with increasing the concentration of the emulsifiers and the stability against Ostwald ripening increased. The most stable nanoemulsions against Ostwald ripening could be prepared with emulsifiers of Tween 20 and Almax 3800 or lecithin in the ratio of 6:4 (wt%), which was verified with Ostwald ripening rate (${\omega}$). In addition, the emulsion stability by Turbiscan was observed to be consistent with results of changes in fat globule size with storage period.

• Tuberculosis and Respiratory Diseases
• /
• 제43권6호
• /
• pp.1019-1027
• /
• 1996

폐의 원발성 림프종은 반응성 림프성 병변과 조직학적으로 감별하기가 어려우나, 반응성 림프증식 증은 polyclonality를 보이는 반면에 악성 림프종은 monoclonality를 보이므로 immunohistochemistry, PCR 분석을 이용하여 감별할 수 있다. 저자 등은 59세 여자 환자에서 개흉폐생검과 lmmunorustochemistry로 진단하고, PCR로 재확인한 악성 B-cell 림프종 1례를 경험 하였기에 문헌고찰과 함께 보고하는 바이다.

• Animal Bioscience
• /
• 제35권8호
• /
• pp.1121-1128
• /
• 2022

Objective: This study aimed to identify the genetic diversity and population structure of Mongolian horse populations according to the province of residence (Khentii, KTP; Uvs, USP; Omnogovi and Dundgovi, GOP; Khovsgol, KGP) using 14 microsatellite (MS) markers. Methods: A total of 269 whole blood samples were obtained from the four populations (KTP, USP, GOP, KGP) geographically distinct provinces. Multiplex polymerase chain reaction (PCR) was conducted using 14 MS markers (AHT4, ASB2, ASB17, ASB23, CA425, HMS1, HMS2, HMS3, HMS6, HMS7, HTG4, HTG6, HTG7, and VHL20), as recommended by the International Society for Animal Genetics. Capillary electrophoresis was conducted using the amplified PCR products, alleles were determined. Alleles were used for statistical analysis of genetic variability, Nei's DA genetic distance, principal coordinate analysis (PCoA), factorial corresponding analysis (FCA), and population structure. Results: On average, the number of alleles, expected heterozygosity (H_Exp), observed heterozygosity (H_Obs), and polymorphic information content among all populations were 11.43, 0.772, 0.757, and 0.737, respectively. In the PCoA and FCA, GOP, and KGP were genetically distinct from other populations, and the KTP and USP showed a close relationship. The two clusters identified using Nei's DA genetic distance analysis and population structure highlighted the presence of structurally clear genetic separation. Conclusion: Overall, the results of this study suggest that genetic diversity between KTP and USP was low, and that between GOP and KGP was high. It is thought that these results will help in the effective preservation and improvement of Mongolian horses through genetic diversity analysis and phylogenetic relationships.

• Journal of Plant Biology
• /
• 제35권2호
• /
• pp.155-163
• /
• 1992

식물세포에 tumor를 유발하는 Agrobacterium tumefaciens pTiA6 plasmid에서 virE 유전자의 발현조절기작을 분자적수준에서 규명하기 위하여 virE promoter의 5＇-말단을 제거하여 얻은 truncated virE 재조합플라스미드를 이용하여 virE promoter의 조절부위에 대하여 연구하였다. virE promoter의 기능이 존재하는 truncated virE 재조합플라스미드인 pJS201은 전기영동에 의하여 virE promoter의 5＇-말단으로부터 약 130개의 염기가 제거된 것으로 측정되었다. 한편 virE promoter의 기능을 상실한 pJS301에서 dideoxy chain termination방법으로 truncated virE promoter 염기서열을 결정한 결과 263개의 염기가 제거된 것으로 확인되었다. 따라서 virE promoter의 조절부위는 virE promoter의 5＇-말단으로부터 약 130번째의 염기에서 263번째의 염기사이에 존재하는 것으로 사료되며, 이 사이에 23개의 염기로 이루어진 역반복서열(AACTTTGCGCTATAGGCAAAGTT)이 존재하고 있는데, 이 부위가 virE operon의 발현에 있어서 RNA polymerase의 최초 인식부위(recognition site)일 것으로 사료된다.