• 한국초지조사료학회지
• /
• 제21권3호
• /
• pp.151-156
• /
• 2001

내열성 유전자인 BcHSP17.6를 갖도록 제작한 발현벡터 pBKH4를 Agrobacterium tumefaciens LBA 4404에 도입후, Agrobacterium과 알팔파 캘러스의 공배양을 통해 감염시킨 캘러스를 $100{\mu}g/m{\ell}$의 kanamycin과 $500{\mu}g/m{\ell}$의 cefotaxim을 첨가한 SH-kc배지에서 배양하며 형질전환된 캘러스를 선발하였다. 식물체 재분화는 SH- nk-c, SH-sp-c, SH-11b-c, SH-1BA 배지에서 약 4개월간 배양하여 재분화를 완성하였으며, 재분화된 알팔파의 genomic DNA를 분리한 후, PCR 분석 및 Southern blot 분석을 실시하여 알팔파의 형질전환을 확인하였다.

• Journal of Microbiology and Biotechnology
• /
• 제18권4호
• /
• pp.754-758
• /
• 2008

Agrobacterium tumefaciens-mediated transformation (ATMT) was successfully applied to Monascus ruber. The optimum cocultivation time was 84 h with an efficiency of 900 to 1,000 transformants when $1{\times}10^6$ spores were used with the same volume of bacteria. The stability of transform ants was over 98% after five generations. When M. ruber was transformed with A. tumefaciens YL-63 containing the green fluorescent protein gene (egfp), the green fluorescent signal was observed throughout hyphae, confirming expression of the gene. This efficient transformation and expression system of M. ruber by ATMT will facilitate the study of this fungus at a molecular genetic level.

• KSBB Journal
• /
• 제27권6호
• /
• pp.341-346
• /
• 2012

Indican (indoxyl-${\beta}$-D-glucoside) is a colorless natural compound and can be used as a precursor for the production of indigo. This production step only require an enzyme, ${\beta}$-glucosidase, that readily screened from microbial resource by using selective media supplemented with indican as a sole carbon source. Agrobacterium tumefaciens was well grown in this media and thus presumed to produce a related enzyme. The corresponding gene, encoding a protein with a calculated molecular mass of 51 kDa, was cloned and overexpressed as MBP fusion proteins. The purified enzyme was determined to be a dimer and showed the maximum activity for indican at pH 7.0 and $40^{\circ}C$. The kinetic parameters for indican, Km and Vmax, were determined to be 1.4 mM and 373.8 ${\mu}M/min/mg$, respectively. The conversion yield of indican into indigo using this enzyme was about 1.7-1.8 folds higher than that of previously isolated enzyme from Sinorhizobium meliloti. Additionally, this enzyme was able to hydrolyze various ${\beta}$-1,4 glycoside substrates.

• Journal of Plant Biotechnology
• /
• 제43권1호
• /
• pp.66-75
• /
• 2016

Agrobacterium-mediated gene transfer has recently been developed to improve rice transformation. In this study, 3 different transformation methods were tested including soaking, co-cultivation, and vacuum infiltration. Agrobacterium tumefaciens GV3101 harboring the binary vector pGreen:: LeGSNOR was used in this experiment. This study aimed to identify the most appropriate method for transferring LeGSNOR into rice. Vacuum infiltration of the embryonic calli for 5 min in Ilpum resulted in high transformation efficiency based on confirmation by PCR, RT-PCR, and qRT-PCR analyses. In conclusion, we described the development of an efficient transformation protocol for the stable integration of foreign genes into rice; furthermore, the study results confirmed that PCR is suitable for efficient detection of the integrated gene. The vacuum infiltration system is a potentially useful tool for future studies focusing on transferring important genes into rice seed calli, and may help reduce time and effort.

• 원예과학기술지
• /
• 제18권6호
• /
• pp.797-801
• /
• 2000

본 연구는 고추에서 Agrobacterium tumefaciens를 이용한 형질 전환시 형질전환율을 높이기 위하여 A. tumefaciens와의 접종시간과 인위적인 상처처리에 따른 효과를 조사하였던 바 고추 형질전환시 자엽절편체의 재분화는 인위적 상처처리 및 A. tumefaciens 접종시간에 의해 영향을 받았다. 접종시간을 3600초로 한 경우의 재분화는 상처처리에 의해 급격히 감소하였으며 자엽 절편체에 대한 인위적인 상처처리가 20초 또는 120초간의 접종시간처리와 병행됨으로써 형질 전환율을 58-72% 이상으로 높이는 효과를 보였다. 형질전환여부의 확인을 ${\beta}$-glucuronidase 염색법과 npt II primer를 이용한 polymerase chain reaction 분석에 의해 수행 한 바 효과적인 것으로 판단되었다.

• 한국작물학회지
• /
• 제49권5호
• /
• pp.415-418
• /
• 2004

The effects of sonication and vacuum infiltration on transformation efficiency was investigated by using immature embryos of Korean wheat as explants. Two Agrobacterium tumefaciens strains, KYRT1 and EHA105, carrying pCAMBIA 1305.1 were used. Transformation efficiency was demonstrated by the detection of $\beta-glucu-ronidase$ (GUS) activity. GUS expression showed clear difference among Korean wheat cultivars. Geurumil showed higher GUS expression efficiency $79.1\%$ compared with other cultivars. The effects of the duration of vacuum infiltration and sonication treatment showed a tendency high GUS expression efficiency by their combination. In comparison with other Agrobacterium strains, KYRT1 showed high efficiency in most Korean cultivars.

• 생명과학회지
• /
• 제15권6호
• /
• pp.1034-1036
• /
• 2005

배추 종자 및 유묘에 대하여 GUS발현 또는 hepatitis B surface antigen (HBsAg)발현 벡터를 지니는 Agrobacterium tumefaciens LBA4404 세포를 이용하여 진공침윤(agroinfiltration)에 의한 형질전환을 시도하였다. 특히 ELISA를 이용한 HBsAg발현의 정량적 분석에서 agroinfiltration방법은 형질전환효율이 매우 저조하게 나타났다. 그러나 차아염소산나트륨 용액을 발아 전 또는 발아 중인 배추종자에 처리한 후 agroinfiltration을 실시한 경우 형질전환 효율이 $2\~5$배 증가하였다. 따라서 차아염소산나트륨 등의 화학연마제에 의한 종자의 상처발생이 Agrobacterium의 감염을 용이하게 함으로써 배추유묘에서의 일시유전자발현을 증대시키는 것으로 제안되고있다.

• Journal of Plant Biotechnology
• /
• 제30권2호
• /
• pp.115-121
• /
• 2003

In this study, plant regeneration and Agrobacterium tumefaciens-mediated transformation Kentucky bluegrass(Poa pratensis L.) were evaluated. Three different types of calli were produced depending on the combinations of growth regulators. They were non-friable brown or gray-colored callus (type I), compact, friable and yellow or white-colored callus (typeII), and soft, watery translucent callus with differentiated structure (typeIII). The highest regenerable organogenic callus (typeII) was obtained on the medium containing 1mg/L, 2,4-D and 0.1mg/L BA. Additionally, the production of typeII calli increased significantly when AgNO$_3$ was added to the callus induction and growth medium. The highest frequency of multiple shout formation from typeII callus was obtained on MS medium containing 1mg/L BA and 1mg/L Thidiazuron(TDZ). The organogenic calli(typeII) were inoculated with Agrobacterium tumefaciens strain EHA101 harboring the binary vector pIG121Hm with $\beta$-glucuronidase gene, and various factors were found to influence the transfer-DNA delivery efficiency. The highest transient GUS activity was observed on typeIIcallus. In the present work, we reported the first transient GUS activity of Kentucky bluegrass mediated by Agrobacterium tumefaciens. Our system may contribute to genetic improvement for breed-recalcirtrant grass species, Kentucky bluegrass.

• Journal of Plant Biology
• /
• 제35권2호
• /
• pp.155-163
• /
• 1992

식물세포에 tumor를 유발하는 Agrobacterium tumefaciens pTiA6 plasmid에서 virE 유전자의 발현조절기작을 분자적수준에서 규명하기 위하여 virE promoter의 5＇-말단을 제거하여 얻은 truncated virE 재조합플라스미드를 이용하여 virE promoter의 조절부위에 대하여 연구하였다. virE promoter의 기능이 존재하는 truncated virE 재조합플라스미드인 pJS201은 전기영동에 의하여 virE promoter의 5＇-말단으로부터 약 130개의 염기가 제거된 것으로 측정되었다. 한편 virE promoter의 기능을 상실한 pJS301에서 dideoxy chain termination방법으로 truncated virE promoter 염기서열을 결정한 결과 263개의 염기가 제거된 것으로 확인되었다. 따라서 virE promoter의 조절부위는 virE promoter의 5＇-말단으로부터 약 130번째의 염기에서 263번째의 염기사이에 존재하는 것으로 사료되며, 이 사이에 23개의 염기로 이루어진 역반복서열(AACTTTGCGCTATAGGCAAAGTT)이 존재하고 있는데, 이 부위가 virE operon의 발현에 있어서 RNA polymerase의 최초 인식부위(recognition site)일 것으로 사료된다.

• Applied Biological Chemistry
• /
• 제28권2호
• /
• pp.92-97
• /
• 1985

Agrobacterium tumefaciens A 136에 자외선은 조사(照射)하여 Ti-plasmid 숙주로 이용할 수 있는 arginine 영양요구주를 선발하고자 하였다. A. tumefaciens의 생육을 600nm에서의 흡광도(吸光度)로 측정할 때 TY배지에서 2% 접종시 7시간 부터 16시간 사이에 대수기를 보였고 generation time은 4.8시간이었다. $800{\mu}w/cm^2$의 자외선 강도로 $30{\sim}50$초 조사(照射)에서 $1{\sim}0.1%$의 생존율을 보였다. 자외선 조사(照射)로 mutation을 유도한 다음 5,000개의 colony에서 15개의 mutants를 얻었으며 그 중 2개는 arginine 영양요구주였고 3개는 asparagine 영양요구주였다.