• Title/Summary/Keyword: Soil-borne disease

Search Result 94, Processing Time 0.028 seconds

Current Studies on Bakanae Disease in Rice: Host Range, Molecular Identification, and Disease Management

  • Yu Na An;Chandrasekaran Murugesan;Hyowon Choi;Ki Deok Kim;Se-Chul Chun
    • Mycobiology
    • /
    • v.51 no.4
    • /
    • pp.195-209
    • /
    • 2023
  • The seed borne disease such as bakanae is difficult to control. Crop yield loss caused by bakanae depending on the regions and varieties grown, ranging from 3.0% to 95.4%. Bakanae is an important disease of rice worldwide and the pathogen was identified as Fusarium fujikuroi Nirenberg (teleomorph: Gibberella fujikuroi Sawada). Currently, four Fusaria (F. fujikuroi, F. proliferatum, F. verticillioides and F. andiyazi) belonging to F. fujikuroi species complex are generally known as the pathogens of bakanae. The infection occurs through both seed and soil-borne transmission. When infection occurs during the heading stage, rice seeds become contaminated. Molecular detection of pathogens of bakanae is important because identification based on morphological and biological characters could lead to incorrect species designation and time-consuming. Seed disinfection has been studied for a long time in Korea for the management of the bakanae disease of rice. As seed disinfectants have been studied to control bakanae, resistance studies to chemicals have been also conducted. Presently biological control and resistant varieties are not widely used. The detection of this pathogen is critical for seed certification and for preventing field infections. In South Korea, bakanae is designated as a regulated pathogen. To provide highly qualified rice seeds to farms, Korea Seed & Variety Service (KSVS) has been producing and distributing certified rice seeds for producing healthy rice in fields. Therefore, the objective of the study is to summarize the recent progress in molecular identification, fungicide resistance, and the management strategy of bakanae.

Development of a Selective Medium for the Fungal Pathogen Cylindrocarpon destructans Using Radicicol

  • Kang, Yunhee;Lee, Seung-Ho;Lee, Jungkwan
    • The Plant Pathology Journal
    • /
    • v.30 no.4
    • /
    • pp.432-436
    • /
    • 2014
  • The soil-borne ascomycete fungus Cylindrocarpon destructans causes ginseng root rot disease and produces various secondary metabolites such as brefeldin A and radicicol. The slow growth of this fungus compared with other plant pathogenic and saprophytic fungi in soil disturbs isolation of this fungus from soil and infected ginseng. In this study, we developed a selective medium for C. destructans using radicicol produced by this fungus. Supplementing 50 mg/L of radicicol to medium inhibited the mycelia growth of other fungi including Botrytis cinerea, Rhizoctonia solani and Alternaria panax, but did not affect the growth of C. destructans. In addition, conidia germination of other fungal species except for C. destructans was inhibited in submerged culture supplemented with radicicol. This medium provides a very efficient tool for isolating C. destructans and also can be used as an enrichment medium for this fungus.

Microbe-Based Plant Defense with a Novel Conprimycin Producing Streptomyces Species

  • Kwak, Youn-Sig
    • 한국균학회소식:학술대회논문집
    • /
    • 2015.05a
    • /
    • pp.54-54
    • /
    • 2015
  • Crops lack genetic resistance to most necrotrophic soil-borne pathogens and parasitic nematodes that are ubiquitous in agroecosystems worldwide. To overcome this disadvantage, plants recruit and nurture specific group of antagonistic microorganisms from the soil microbiome to defend their roots against pathogens and other pests. The best example of this microbe-based defense of roots is observed in disease-suppressive soils in which the suppressiveness is induced by continuously growing crops that are susceptible to a pathogen. Suppressive soils occur globally yet the microbial basis of most is still poorly described. Fusarium wilt, caused by Fusarium oxysporum f. sp. fragariae is a major disease of strawberry and is naturally suppressed in Korean fields that have undergone continuous strawberry monoculture. Here we show that members of the genus Streptomyces are the specific bacterial components of the microbiome responsible for the suppressiveness that controls Fusarium wilt of strawberry. Furthermore, genome sequencing revealed that Streptomyces griseus, which produces a novel thiopetide antibiotic, is the principal species involved in the suppressiveness. Finally, chemical-genetic studies demonstrated that S. griseus antagonizes F. oxysporum by interfering with fungal cell wall synthesis. An attack by F. oxysporum initiates a defensive "cry for help" by strawberry root and the mustering of microbial defenses led by Streptomyces. These results provide a model for future studies to elucidate the basis of microbially-based defense systems and soil suppressiveness from the field to the molecular level.

  • PDF

Incidence of Diseases in Codonopsis lanceolata with Different Cultivation Method (재배양식에 따른 더덕 병해 발생양상)

  • 김주희;최정식
    • Korean Journal Plant Pathology
    • /
    • v.14 no.6
    • /
    • pp.676-681
    • /
    • 1998
  • Disease incidence of Codonopsis lanceolata was surveyed at the major cultivating fields in Chonbuk province in 1996 to 1997. The main diseases of Codonopsis lanceolata were ovserved as leaf spot caused by Septoria codonopsis, anthracnose by Glomerella cingulata, brown leaf spot by Cercospora sp., rust by Coleosporium koreanum, powdery mildew by Erysiphe sp., Fusarium wilt caused by Fusarium oxyporum, and white root rot by Sclerotium rolfsii. Anthracnose, leaf spot and brown leaf spot occurred severely on leaves from early July to late August. They were caused early fallen leaves. Fusarium wilt and white root rot occurred severely on stem and below the soil line in late August. They resulted in withering to death or chlorosis and fallen of leaves. Disease incidence of Codonopsis lanceolata was also substantially different in occurrence with a method of cultivation in late growth stage. Fusarium wilt and white root rot were more severe with a method of no support cultivation than those with a method of support cultivation with a stick. Fusarium wilt occurred 48.8% in a method of no support cultivation but 3.1% in a method of support cultivation with a stick. And white root rot occurred 18.9% in a method of no support cultivation but 0.3% in a method of no support cultivation with a stick. Thus, it proved that soil-borne diseases could be controlled support cultivation with a stick.

  • PDF

Detection of Barley yellow mosaic virus from Soil Using Nested PCR (Nested PCR 기법을 이용한 토양으로부터 Barley yellow mosaic virus 검출)

  • Lee, Joong-Hwan;Son, Chang-Gi;Kwon, Joong-Bae;Nam, Hyo-Hun;Kim, Yeong-Tae;Lee, Bong-Choon;Shin, Dong-Bum
    • Research in Plant Disease
    • /
    • v.23 no.1
    • /
    • pp.65-68
    • /
    • 2017
  • Barley yellow mosaic virus (BaYMV), which is transmitted by the root-inhabiting protist Polymyxa graminis, causes a soil-borne disease. In this study, we detected BaYMV from soil using two-step nested polymerase chain reaction (PCR). Specific primers based on a coat protein region of BaYMV segment RNA1 were used in the first round of amplification. Based on the sequenced amplicon, an inner primer was designed for the second round of amplification. A PCR product of 372 bp exhibited 98%-100% nucleotide sequence identity with the coat protein region of BaYMV segment RNA1. In this study, we propose an easy method for the detection of BaYMV from soil, may considerably assist in accurate fungus-transmitted virus diagnosis and subsequent disease forecasting. This is the first report on the detection of BaYMV from soil.

Development of an In Planta Molecular Marker for the Detection of Chinese Cabbage (Brassica campestris ssp. pekinensis) Club Root Pathogen Plasmodiophora brassicae

  • Kim, Hee-Jong;Lee, Youn-Su
    • Journal of Microbiology
    • /
    • v.39 no.1
    • /
    • pp.56-61
    • /
    • 2001
  • Plasmodiophora brassicae is an obligate parasite, a causal organism of clubroot disease in crucifers that can survive in the soil as resting spores for many years. P. brassicae causes great losses in susceptible varieties of crucifers throughout the world. In this present study, an in planta molecular marker for the detection of P. bassicae was developed using an oligonucleotide primer set foam the small subunit gene (18S like) and internal transcribed spacer (ITS) region of rDNA. The specific primer sequences determined were TCAGCTTGAATGCTAATGTG (ITS5) and CTACCTCATTTGAGATCCTTTGA (PB-2). This primer set was used to specifically detect p. bassicae in planta. The amplicon using the specific primer set was about 1,000 bp. However, the test plant and other soil-borne fungi including Fusarium spp. and Rhizoctonia app., as well as bacteria such as Pseudomonas app. and Erwinia sup. did not show any reaction with the primer set.

  • PDF

Effects of ectomycorrhizal fungi on soil-borne plant pathogenic fungi in red pine seedlings

  • Seo, Il-Won;Lee, Jong-Kyu
    • Proceedings of the Korean Society of Plant Pathology Conference
    • /
    • 2003.10a
    • /
    • pp.89.1-89
    • /
    • 2003
  • Disease suppression by ectomycorrhizal(ECM) fungi has been demonstrated on red pine seedlings. Culturing of pathogenic fungi on petri plates containing culture filtrates of ECM fungi showed that culture filtrates of the ECM fungus Hebeloma cylindrosporum may inhibit the mycelial growth of all tested soil-borne plant pathogenic(SBPP) fungi upto 60%, In order to examine the effects of ECM fungi on SBPP fungi and on red pine seedlings, both symbiotic and pathogenic fungi were inoculated into the soil with red pine seedlings by three inoculation methods; pre-inoculation of SBPP fungi 10 days before inoculation of ECM fungi, simultaneous inoculation of both fungi, post-inoculation of SBPP fungi 60 days after inoculation of ECM fungi. Seedling mortality, seedling growth, and ectomycorrhizal formation by the combined treatments were examined and compared. Pine seedlings were dead by the pre-inoculation of pathogenic fungi, except Rhizina undulate which required 9-12 days, within 6 days after inoculation. Among pathogenic fungi tested, Fusarium oxysporum was the most pathogenic with the mortality of 44%. However, no dead seedlings were shown by simultaneous inoculation of both fungi or pre-inoculation of ECM fungi. In addition, pine seedlings treated by simultaneous or post-inoculation of SBPP fungi were relatively higher than those treated by pre-inoculation in diameter at root crown and the number of ectomycorrhizal roots. There were no significant differences among inoculation methods in root length and dry weight of treated seedlings. It means that ECM fungi somehow play a role in protecting primary roots of red pine seedlings against invasion by the SBPP fungi.

  • PDF

Role of Siderophores in Biocontrol of Fusarium solani and Enhanced Growth Response of Bean by Pseudomonas fluorescens GL20

  • Lim, Ho-Seong;Kim, Sang-Dal
    • Journal of Microbiology and Biotechnology
    • /
    • v.7 no.1
    • /
    • pp.13-20
    • /
    • 1997
  • Plant growth-promoting Psudomonas fluorescens GL20 was isolated from a ginseng rhizosphere on chrome azurol Sagar. P. fluorescens GL20 produced a large amount of hydoxamate siderophore in an iron-deficient medium. The siderophore showed significantly high specific activity of 20.2 unit. Using an in vitro antifungal test, P. fluorescens GL20 considerably suppressed growth of phytopathogenic fungus Fusarium solani, inhibiting spore germination and germ tube elongation. In pot trials of kidney beans with P. fluorescens GL20, disease incidence was remarkably reduced up to $68{\%}$ compared with that of F. solani alone, and plant growth was also increased nearly 1.6 fold as compared to that of the untreated control, promoting elongation and development of the roots. These results indicate that the plant growth-promoting activity of P. fluorescens GL20 can play an important role in biological control of soil-borne plant disease in a rhizosphere, enhancing the growth of plants.

  • PDF

국내 기생충 질환의 현황 및 전망

  • Chae, Jong-Il
    • Journal of Korea Association of Health Promotion
    • /
    • v.1 no.1
    • /
    • pp.26-32
    • /
    • 2003
  • The current status and future prospects of parasitic infections in Korea is briefly reviewed. Soil-transmitted helminth infections including ascariasis, trichuriasis, and hookworm infections decreased remarkably. owing to the national control activities excuted by the Korea Association of Health Promotion(formerly Korea Association of parasite Eradication) using mass heath education. Important recent trends include reemergence of vivax malaria since 1993, persistence of food-borne trematode infections including clonorchiasis and intestinal trematode infections, increased detection of zoonotic parasitosis, close-up of infection with opportunistic parasites including cryptosporidiosis, toxoplasmosis, and pneumosytosis, increase of imported tropical infectious disease, appearance of new parasitic disease such as gymnophalloidiasis, and increase of accidental infections with free-living amoebae. These trends represent greatly changed overall patterns of parasitic infections in Korea.

  • PDF