• Journal of Applied Biological Chemistry
• /
• v.49 no.4
• /
• pp.171-175
• /
• 2006

Chitin compost and broth were used to suppress club root. Individual cabbage seedlings were transplanted into pots(3500 ml) containing a mixture of 3% chitin compost and 50 ml of chitin broth (T1) or the same quantity control compost and control compost broth(T2). The media in each pot was then infected with Plasmodiophora brassicae. Samples were taken at 6, 7 and 8 weeks after transplanting. The population of chitinase producing bacteria in T1 was consistently larger than that observed in T2. Chitinase activity in the T1 rhizosphere was two-fold greater than that of T2 at each time point observed. Shoot dry weight, leaf number and leaf area in T1 were enhanced 20%, 10% and 12% relative to those seen in T2, respectively. The disease index and root mortality at 8 weeks after transplanting were reduced by 50% and 25% in T1 compared to T2, respectively. Results presented in this study are strongly indicative that chitin compost and broth suppress clubroot in Chinese cabbage.

• Plant Disease and Agriculture
• /
• v.5 no.2
• /
• pp.90-94
• /
• 1999

Effect of inoculum concentration inoculation method and plant age on development of clubroot disease of Chinese cabbage seedling were examined in growth chambers. Root galls were developed at the concentration of 105 resting spore or above per ml of incoulum and as the inoculum concentration became higher rate of development of root galls was faster. In the plants with root gall development fresh weight of above ground parts was reduced to 30-44% of that of healthy plants but root weight increased by 4-10 times. Growth of diseased plants was greatly reduced as compared to healthy plants. Planting in the diseased soil as a inoculation method was most effective for disease development showing uniform infections but time of initial root gall development was delayed by root soaking inoculation. Some plants inoculated by soil drenching method did not develop root galls. However root gall enlargement after its initial formation did not differ greatly among inoculation methods. Nine-day-old seedlings showed poor development of root gall but 16-days-old seedlings was found to be most adequate for inoculation for gall development.

• The Plant Pathology Journal
• /
• v.19 no.1
• /
• pp.64-68
• /
• 2003

Cruciferous vegetable crops grown in several locations in Korea were surveyed from 1996 to 2000. Clubroot severely occurred up to a maximum of 100％ in Chinese cabbage fields in 15 out of 42 locations, and in cabbage fields in 5 out of 13 locations surveyed. The disease also severely occurred up to a maximum of 40％ in radish fields in 6 out of 35 locations, and up to a maximum of 40% and 100％ in turnip and brown mustard fields in one each out of the few locations surveyed, respectively. The disease occurred less than l％ in one kale field in one out of two locations surveyed. A total of 268 isolates of Plasmodiophora brassicae was obtained from six cruciferous vegetable crops. The isolates were classified into 13 races based on their pathogenicity to the differential varieties of cabbage and rutabaga. There were 13 races found in isolates from Chinese cabbage, while 6 races each were found in isolates from cabbage and radish. There were five and three races found in turnip and brown mustard isolates, respectively. One isolate from kale was identified as race 8. Race 8 was the most frequently isolated from five cruciferous vegetable crops, except brown mustard. Races 3 and 14 were isolated only from Chinese cabbage.

• Horticultural Science & Technology
• /
• v.29 no.6
• /
• pp.610-616
• /
• 2011

Clubroot disease caused by Plasmodiophora brassicae, induces damage to cruciferous vegetables worldwide. For control of the disease, many CR (clubroot resistant) $F_1$ hybrid cultivars of Chinese cabbage have been bred and released in Korea. In this study, we determined the race of 10 field isolates of P. brassicae collected from ten regions in Korea using Williams' differential varieties and investigated the degree of resistance of 25 commercial CR cultivars of Chinese cabbage to the isolates. The clubroot pathogens were assigned into two (HS and YC), two (HN1 and HN2), two (DJ and SS) and four (GS, GN, JS, and PC) isolates for race 2, race 4, race 5, race 9, respectively. All CR cultivars showed similar response, resistant or susceptible, to each isolate and the P. brassicae isolates were divided into two groups. Among them, the DJ, GS, GN, HS, and JS isolates could not infect the CR cultivars. In contrast, the SS, HN1, HN2, PC, and YC isolates caused severe clubroot disease on the CR cultivars like susceptible cultivars. Even though they belong to the same race, the CR cultivars showed a different response to the pathogens. The results suggest that the breakdown of CR in Chinese cabbage has already occurred in cultivation areas of Korea and resistance source introduced in CR cultivars may be very limited. In addition, it is likely that resistance genes of Williams' differential varieties to P. brassicae are different from the gene of CR cultivars of Chinese cabbage used in the study.

• Research in Plant Disease
• /
• v.17 no.2
• /
• pp.161-168
• /
• 2011

To establish simple and reliable screening method for resistant radish to Plasmodiophora brassicae Woron. using soil-drenching inoculation, the development of clubroot on radish seedlings inoculated with P. brassicae GN-1 isolate according to several conditions such as inoculum concentration, plant growth stage and incubation period after inoculation was studied. To select resistant radish against clubroot, 10-day-old seedlings were inoculated with P. brassicae by drenching the roots with the spore suspension of the pathogen to give $1{\times}10^9$ spores/pot. The inoculated seedlings were incubated in a growth chamber at $20^{\circ}C$ for 3 days then cultivated in a greenhouse ($20{\pm}5^{\circ}C$) for 6 weeks. Under the optimum conditions, 46 commercial cultivars of radish were tested for resistance to YC-1 (infecting 15 clubroot-resistant cultivars of Chinese cabbage) and GN-1 (wild type) isolates of P. brassicae. Among them, thirty-five cultivars showed resistance to both isolates and one cultivar represented susceptible response to the pathogens. On the other hand, the other cultivars showed different responses against the tested P. brassicae pathogens. The results suggest that this method is an efficient system for screening radish with resistance to clubroot.

• The Korean Journal of Pesticide Science
• /
• v.9 no.1
• /
• pp.81-87
• /
• 2005

Ethaboxam[(RS)-N-(a-cyano-2-thenyl)-4-ethyl-2-(ethylamino)-1,3-thiazole-5-carboximide] is a novel fungicide with high level of activity against Oomycetes fungi. The control effects of ethaboxam technical and various ethaboxam formulations were investigated against P. brassicae, the causal agent of clubroot disease in Chinese cabbage. When ethaboxam was applied to infested soil, club formation caused by P. brassicae was strongly inhibited at 8.33 mg/L soil and $EC_{50}$ of ethaboxam was 2.65 mg/L soil. Five ethaboxam formulations [10% suspension concentrate (SC), 15% SC, 2% granule (GR), 5% GR, 25% wettable powder] and mixture formulation of ethaboxam and metalaxyl (3%+1% GR) exhibited good efficacy against the pathogen. 10% SC, 15% SC, and 2% GR formulations of ethaboxam showed better disease controlling efficacy on Chinese cabbage clubroot than the other formulations. The $EC_{50}$ values of 10% SC, 15% SC, and 2% GR formulations of ethaboxam were 3.72 mg AI/L soil, 1.1 mg AI/L soil, and 4.95 mg AI/L soil, respectively. Among them, soil drenching application by 15% SC formulation of ethaboxam exhibited the most in vivo antifungal activity on P. brassicae. These results indicate that ethaboxam has a high potential for the control of clubroot disease.

• Research in Plant Disease
• /
• v.11 no.1
• /
• pp.43-47
• /
• 2005

To investigate control efficacy of flusulfamide GR (granule) on Chinese cabbage clubroot caused by Plasmodiophora brassicae, experiment was accomplished in field located in Gangneungshi alpine area contaminated by P. brassicae. Flusulfamide GR provided control value of 84.6% and that was statistically significant difference from standard fungicides containing untreated control. To investigate ratio of reduction of resting spore according to fungicide treatment, soil of Chinese cabbage field before and after fungicide treatment were sampled and investigated density of resting spore. Resting spore density was not uniform in soil before fungicide treatment. Therefore, to investigate control efficacy of fungicide against clubroot, investigation on resting spore density was conducted before experiment and reflected in experimental design. Flusulfamide GR and DP (dust powder) provided 64.2% and 63.7% of reduction of resting spore on field soil after fungicide treatments. This result indicated that control efficacy of the fungicides was correlated with reduction of resting spore of P. brassicae. The increasing rate in fresh weight of above-ground part of Chinese cabbage by flusulfamide DP and GR, fluazinam DP and trifloxystrobin SC (suspension concentrate) was 14.3%, 13.0%, 13.8% and 3.8%, respectively. From above result, flusulmide GR have outstanding control efficacy against clubroot of Chinese cabbage and is effectively decreasing of resting spore density in soil.

• Journal of Microbiology
• /
• v.39 no.1
• /
• pp.56-61
• /
• 2001

Plasmodiophora brassicae is an obligate parasite, a causal organism of clubroot disease in crucifers that can survive in the soil as resting spores for many years. P. brassicae causes great losses in susceptible varieties of crucifers throughout the world. In this present study, an in planta molecular marker for the detection of P. bassicae was developed using an oligonucleotide primer set foam the small subunit gene (18S like) and internal transcribed spacer (ITS) region of rDNA. The specific primer sequences determined were TCAGCTTGAATGCTAATGTG (ITS5) and CTACCTCATTTGAGATCCTTTGA (PB-2). This primer set was used to specifically detect p. bassicae in planta. The amplicon using the specific primer set was about 1,000 bp. However, the test plant and other soil-borne fungi including Fusarium spp. and Rhizoctonia app., as well as bacteria such as Pseudomonas app. and Erwinia sup. did not show any reaction with the primer set.

• Proceedings of the Korean Society of Plant Pathology Conference
• /
• 2003.10a
• /
• pp.9-12
• /
• 2003

Clubroot disease of curcifer crops caused by Plasmodiophora brassicae had been first reported in 1920 in Korea, and maintained mild occurrence until 1980s. Since 1990s the disease has become severe in alpine areas of Kyonggi and Kangwon, gradually spread to plain fields throughout the country, and remains as the greatest limiting factor for its production. Researches on the disease has begun in late 1990s in our laboratory after experiencing severe epidemics. Survey of occurrence and etiological and ecological studies have been carried out, particularly, on the pathogen physiology, race identification, quantification of soil pathogen population, host spectrum of the pathogen, and control measures.(중략)

• Korean Journal Plant Pathology
• /
• v.14 no.6
• /
• pp.589-593
• /
• 1998

DNA amplification by polymerase chain reaction (PCR) was used to specifically detect Plasmodiophora brassicae, causing clubroot of crucifers. On the basis of DNA sequence informations, an oligonucleotide primer set specific for the pathogen was designed form small subunit gene (18S-like) and internal transcribed spacer (ITS) region of ribosomal DNA. Primer ITS 5/PB-C produced an amplification product of approximately 520 bp in length with DNA from P. brassicae. However, no amplification product was produced with DNAs from several soil-borne fungi, Didymella bryoniae and Rhizopus stolonifer. Using these primers, the clubroot pathogen was readily detected from infected roots of crucifers, but not from healthy roots. Southern hybridization analysis further confirmed that the amplification product was originated from P. brassicae.