• Journal of Applied Biological Chemistry
• /
• 제49권4호
• /
• pp.171-175
• /
• 2006

Chitin compost and broth were used to suppress club root. Individual cabbage seedlings were transplanted into pots(3500 ml) containing a mixture of 3% chitin compost and 50 ml of chitin broth (T1) or the same quantity control compost and control compost broth(T2). The media in each pot was then infected with Plasmodiophora brassicae. Samples were taken at 6, 7 and 8 weeks after transplanting. The population of chitinase producing bacteria in T1 was consistently larger than that observed in T2. Chitinase activity in the T1 rhizosphere was two-fold greater than that of T2 at each time point observed. Shoot dry weight, leaf number and leaf area in T1 were enhanced 20%, 10% and 12% relative to those seen in T2, respectively. The disease index and root mortality at 8 weeks after transplanting were reduced by 50% and 25% in T1 compared to T2, respectively. Results presented in this study are strongly indicative that chitin compost and broth suppress clubroot in Chinese cabbage.

• 식물병과 농업
• /
• 제5권2호
• /
• pp.90-94
• /
• 1999

Effect of inoculum concentration inoculation method and plant age on development of clubroot disease of Chinese cabbage seedling were examined in growth chambers. Root galls were developed at the concentration of 105 resting spore or above per ml of incoulum and as the inoculum concentration became higher rate of development of root galls was faster. In the plants with root gall development fresh weight of above ground parts was reduced to 30-44% of that of healthy plants but root weight increased by 4-10 times. Growth of diseased plants was greatly reduced as compared to healthy plants. Planting in the diseased soil as a inoculation method was most effective for disease development showing uniform infections but time of initial root gall development was delayed by root soaking inoculation. Some plants inoculated by soil drenching method did not develop root galls. However root gall enlargement after its initial formation did not differ greatly among inoculation methods. Nine-day-old seedlings showed poor development of root gall but 16-days-old seedlings was found to be most adequate for inoculation for gall development.

• The Plant Pathology Journal
• /
• 제19권1호
• /
• pp.64-68
• /
• 2003

Cruciferous vegetable crops grown in several locations in Korea were surveyed from 1996 to 2000. Clubroot severely occurred up to a maximum of 100％ in Chinese cabbage fields in 15 out of 42 locations, and in cabbage fields in 5 out of 13 locations surveyed. The disease also severely occurred up to a maximum of 40％ in radish fields in 6 out of 35 locations, and up to a maximum of 40% and 100％ in turnip and brown mustard fields in one each out of the few locations surveyed, respectively. The disease occurred less than l％ in one kale field in one out of two locations surveyed. A total of 268 isolates of Plasmodiophora brassicae was obtained from six cruciferous vegetable crops. The isolates were classified into 13 races based on their pathogenicity to the differential varieties of cabbage and rutabaga. There were 13 races found in isolates from Chinese cabbage, while 6 races each were found in isolates from cabbage and radish. There were five and three races found in turnip and brown mustard isolates, respectively. One isolate from kale was identified as race 8. Race 8 was the most frequently isolated from five cruciferous vegetable crops, except brown mustard. Races 3 and 14 were isolated only from Chinese cabbage.

• 원예과학기술지
• /
• 제29권6호
• /
• pp.610-616
• /
• 2011

Plasmodiphora brassicae에 의해 발생하는 뿌리혹병은 전세계 십자화과 작물에 많은 피해를 주고 있다. 본 연구에서는 우리나라 여러 지역으로부터 10개의 뿌리혹병균을 채집하여 Williams 판별품종을 이용하여 레이스를 검정하고, 이들 균주에 대한 뿌리혹병 저항성(CR) 배추 품종 25개의 저항성 정도를 조사하였다. 실험한 뿌리혹병균 중 HS와 YC 균주는 레이스 2, HN1과 HN2는 레이스 4, DJ와 SS 균주는 레이스 5 그리고 GS, GN, JS 및 PC 균주는 레이스 9로 동정되었다. 시판 중인 25개 CR 배추 품종의 이들 균주에 대한 저항성을 조사한 결과, 각 균주에 대하여 25개 CR 품종은 거의 동일하게 반응하였으며, 뿌리혹병균의 레이스와 관계없이 두 종류의 반응을 나타냈다. DJ, GS, GN, HS 및 JS 등의 5개 균주에는 저항성 반응을 나타내었으며, SS, HN1, HM2, PC 및 YC 균주에 의해서는 감수성 품종과 동일한 정도의 뿌리혹병 발생을 보였다. 이상의 결과로부터 우리나라 포장에는 CR 배추를 감염하는 뿌리혹병균이 이미 존재하고 있으며, 실험한 CR 품종들의 저항성 유전자원은 매우 단순하다고 생각되었다. 또 동일한 레이스의 뿌리혹병균도 CR 품종에 다른 반응을 나타내므로 CR 배추 품종의 저항성 유전자는 Williams 판별 기주의 저항성 유전자와 다르다고 추정된다.

• 식물병연구
• /
• 제17권2호
• /
• pp.161-168
• /
• 2011

Plasmodiophora brassicae Woron.에 의해 발생하는 무 뿌리혹병에 대한 효율적인 저항성 검정법을 확립하기 위하여, GN-1 균주를 사용하여 접종원 농도, 무 생육 시기 및 접종 후 배양 기간 등 발병 조건에 따른 무 뿌리혹병발생을 조사하였다. 종자를 파종하고 10일 동안 재배한 무 유묘에 뿌리혹병균을 포트 당 $1.0{\times}10^9$개의 포자 농도가 되도록 관주하여 접종하였을 때 뿌리혹병이 가장 많이 발생하였다. 그리고 뿌리혹병 발생을 위해서, 접종한 무 유묘는 $20^{\circ}C$ 생육상에서 하루에 12시간 동안 광을 처리하며 3일 동안 배양하고, 그 후 온실($20{\pm}5^{\circ}C$)에서 6주 동안 재배한 후에 발병 정도를 조사하는 것이 효율적이었다. 확립한 무 뿌리혹병 저항성 검정법을 이용하여, 시판 중인 무 품종 46개의 P. brassicae GN-1 균주(저항성 배추 품종을 침입할 수 없는 균주)와 YC-1 균주(15개 저항성 배추 품종에 뿌리혹병을 일으키는 균주)에 대한 저항성 정도를 실험한 결과, 실험한 무 품종 중 35개 품종은 두 균주 모두에 대하여 저항성을, 그리고 1개 품종은 감수성을 나타내었다. 한편, 나머지 10개 품종은 균주에 따라 서로 다른 반응을 나타냈다. 이상의 결과로부터 본 연구에서 확립한 뿌리혹병 저항성 검정법은 뿌리혹병균에 대한 무의 저항성을 조사하기 위한 효율적인 방법임을 알 수 있었다.

• 농약과학회지
• /
• 제9권1호
• /
• pp.81-87
• /
• 2005

Ethaboxam[(RS)-N-(a-cyano-2-thenyl)-4-ethyl-2-(ethylamino)-1,3-thiazole-5-carboximide]은 난균강 미생물에 대하여 우수한 살균활성을 보이는 신규 살균제이다. Ethaboxam 원제와 몇 가지 ethaboxam 제형의 배추 뿌리혹병에 대한 방제효과를 조사하였다. Ethaboxam을 관주처리 하였을 때, 토양 1 L 당 8.33 mg 농도 처리구는 배추 뿌리의 혹 형성이 완전히 억제되었으며, $EC_{50}$ 값은 2.65 mg/L 토양이었다. Ethaboxam 5개 제형(10% 액상수화제, 15% 액상수화제, 2% 입제, 5% 입제, 25% 수화제) 그리고 ethaboxam과 metalaxyl 합제 제형(3%+1% 입제)의 배추 뿌리혹병 방제효과는 우수하였다. 이들 중 토양 관주처리 한 ethaboxam의 10% 및 15% 액상수화제, 토양 혼화처리 한 ethaboxam 2% 입제 제형은 다른 제형보다 배추 뿌리혹병에 대하여 더 우수한 방제효과를 보였다. 이들의 배추 뿌리혹병에 대한 $EC_{50}$ 값은 원제기준으로 토양 L 당 각각 3.72 mg(10% 액상수화제), 1.10 mg (15% 액상수화제), 4.95 mg (2% 입제) 이었다. 그러므로 실험한 ethaboxam 6개 제형 중에 15% 액상수화제가 배추 뿌리혹병에 대하여 가장 우수한 방제효과를 나타냄을 알 수 있었다. 이들 결과로부터 ethaboxam은 포장에서도 배추 뿌리혹병을 효과적으로 방제할 수 있으리라 생각되었다.

• 식물병연구
• /
• 제11권1호
• /
• pp.43-47
• /
• 2005

Flisulfamide 입제의 포장에서 방제효과 변화를 조사하기 위하여 강릉신의 배추 뿌리혹병에 오염된 고랭지 포장에서 본 시험을 진행하였다. Flisulfamide 입제는 84.6% 의 방제가로 무처리구와 기타 대조약제에 비교하여 통계적으로 유의성이 있는 것으로 나타났다. 휴면포자의 감소율을 조사하기 위하여 시험포장의 모든 처리구의 각 반복당 임의의 5개 지점에서 약제 처리 전 토양과 약제 처리 후 토양을 채집하여, 토양내의 휴면포자의 밀도를 조사하였다. 처리 전 시험 포자으이 휴면포자 밀도는 균일하지 않았으므로 포장 시험시 처리전 휴면포자 밀도의 조사가 필요하다고 생각된다. 휴면포자의 감소율을 조사한 결과, flisulfamide 분제와 입제를 처리한 후 휴면포자 밀도는 처리전에 비하여 63.7% 와 64.2% 의 감소율을 나타냈다. 방제효과와 휴면포자의 감소율간에는 유효적인 상관관계가 있게 나타났다. 그리고 약제 처리에 의한 수확량 변화를 조사하기 위하여, 약제 처리 45일 후, 각 처리구에서 20주의 배추를 수확하여 지상부 무게를 측정하였다. Flisulfamide 분제, fluazinam 분재와 flisulfamide 입제의 처리구에서 수확량은 무처리구에 비하여 14.3%, 13.8%와 13.0% 의 수확량 증가율을 나타냈고, trifloxystrobin 액상수화제의 처리구에서 수확량은 무처리구에 비하여 3.8%의 증가율을 나타냈다. 대조구를 포함한 각 처리평균간에는 통계적 유의성(P=0.05)은 없는 것으로 나타났다. 이상의 결과로부터 flisulfamide 입제가 배추 뿌리혹병의 방제에 있어서 우수한 방제효과를 가지고 있으며, 또한 휴면포자의 밀도를 감소하는데 효과적임을 알 수 있다.

• Journal of Microbiology
• /
• 제39권1호
• /
• pp.56-61
• /
• 2001

Plasmodiophora brassicae is an obligate parasite, a causal organism of clubroot disease in crucifers that can survive in the soil as resting spores for many years. P. brassicae causes great losses in susceptible varieties of crucifers throughout the world. In this present study, an in planta molecular marker for the detection of P. bassicae was developed using an oligonucleotide primer set foam the small subunit gene (18S like) and internal transcribed spacer (ITS) region of rDNA. The specific primer sequences determined were TCAGCTTGAATGCTAATGTG (ITS5) and CTACCTCATTTGAGATCCTTTGA (PB-2). This primer set was used to specifically detect p. bassicae in planta. The amplicon using the specific primer set was about 1,000 bp. However, the test plant and other soil-borne fungi including Fusarium spp. and Rhizoctonia app., as well as bacteria such as Pseudomonas app. and Erwinia sup. did not show any reaction with the primer set.

• 한국식물병리학회:학술대회논문집
• /
• 한국식물병리학회 2003년도 정기총회 및 추계학술발표회
• /
• pp.9-12
• /
• 2003

Clubroot disease of curcifer crops caused by Plasmodiophora brassicae had been first reported in 1920 in Korea, and maintained mild occurrence until 1980s. Since 1990s the disease has become severe in alpine areas of Kyonggi and Kangwon, gradually spread to plain fields throughout the country, and remains as the greatest limiting factor for its production. Researches on the disease has begun in late 1990s in our laboratory after experiencing severe epidemics. Survey of occurrence and etiological and ecological studies have been carried out, particularly, on the pathogen physiology, race identification, quantification of soil pathogen population, host spectrum of the pathogen, and control measures.(중략)

• 한국식물병리학회지
• /
• 제14권6호
• /
• pp.589-593
• /
• 1998

DNA amplification by polymerase chain reaction (PCR) was used to specifically detect Plasmodiophora brassicae, causing clubroot of crucifers. On the basis of DNA sequence informations, an oligonucleotide primer set specific for the pathogen was designed form small subunit gene (18S-like) and internal transcribed spacer (ITS) region of ribosomal DNA. Primer ITS 5/PB-C produced an amplification product of approximately 520 bp in length with DNA from P. brassicae. However, no amplification product was produced with DNAs from several soil-borne fungi, Didymella bryoniae and Rhizopus stolonifer. Using these primers, the clubroot pathogen was readily detected from infected roots of crucifers, but not from healthy roots. Southern hybridization analysis further confirmed that the amplification product was originated from P. brassicae.