Chitin compost and broth were used to suppress club root. Individual cabbage seedlings were transplanted into pots(3500 ml) containing a mixture of 3% chitin compost and 50 ml of chitin broth (T1) or the same quantity control compost and control compost broth(T2). The media in each pot was then infected with Plasmodiophora brassicae. Samples were taken at 6, 7 and 8 weeks after transplanting. The population of chitinase producing bacteria in T1 was consistently larger than that observed in T2. Chitinase activity in the T1 rhizosphere was two-fold greater than that of T2 at each time point observed. Shoot dry weight, leaf number and leaf area in T1 were enhanced 20%, 10% and 12% relative to those seen in T2, respectively. The disease index and root mortality at 8 weeks after transplanting were reduced by 50% and 25% in T1 compared to T2, respectively. Results presented in this study are strongly indicative that chitin compost and broth suppress clubroot in Chinese cabbage.
Effect of inoculum concentration inoculation method and plant age on development of clubroot disease of Chinese cabbage seedling were examined in growth chambers. Root galls were developed at the concentration of 105 resting spore or above per ml of incoulum and as the inoculum concentration became higher rate of development of root galls was faster. In the plants with root gall development fresh weight of above ground parts was reduced to 30-44% of that of healthy plants but root weight increased by 4-10 times. Growth of diseased plants was greatly reduced as compared to healthy plants. Planting in the diseased soil as a inoculation method was most effective for disease development showing uniform infections but time of initial root gall development was delayed by root soaking inoculation. Some plants inoculated by soil drenching method did not develop root galls. However root gall enlargement after its initial formation did not differ greatly among inoculation methods. Nine-day-old seedlings showed poor development of root gall but 16-days-old seedlings was found to be most adequate for inoculation for gall development.
Cruciferous vegetable crops grown in several locations in Korea were surveyed from 1996 to 2000. Clubroot severely occurred up to a maximum of 100% in Chinese cabbage fields in 15 out of 42 locations, and in cabbage fields in 5 out of 13 locations surveyed. The disease also severely occurred up to a maximum of 40% in radish fields in 6 out of 35 locations, and up to a maximum of 40% and 100% in turnip and brown mustard fields in one each out of the few locations surveyed, respectively. The disease occurred less than l% in one kale field in one out of two locations surveyed. A total of 268 isolates of Plasmodiophora brassicae was obtained from six cruciferous vegetable crops. The isolates were classified into 13 races based on their pathogenicity to the differential varieties of cabbage and rutabaga. There were 13 races found in isolates from Chinese cabbage, while 6 races each were found in isolates from cabbage and radish. There were five and three races found in turnip and brown mustard isolates, respectively. One isolate from kale was identified as race 8. Race 8 was the most frequently isolated from five cruciferous vegetable crops, except brown mustard. Races 3 and 14 were isolated only from Chinese cabbage.
Jo, Su-Jung;Shim, Sun-Ah;Jang, Kyoung-Soo;Choi, Yong-Ho;Kim, Jin-Cheol;Choi, Gyung-Ja
Horticultural Science & Technology
/
v.29
no.6
/
pp.610-616
/
2011
Clubroot disease caused by Plasmodiophora brassicae, induces damage to cruciferous vegetables worldwide. For control of the disease, many CR (clubroot resistant) $F_1$ hybrid cultivars of Chinese cabbage have been bred and released in Korea. In this study, we determined the race of 10 field isolates of P. brassicae collected from ten regions in Korea using Williams' differential varieties and investigated the degree of resistance of 25 commercial CR cultivars of Chinese cabbage to the isolates. The clubroot pathogens were assigned into two (HS and YC), two (HN1 and HN2), two (DJ and SS) and four (GS, GN, JS, and PC) isolates for race 2, race 4, race 5, race 9, respectively. All CR cultivars showed similar response, resistant or susceptible, to each isolate and the P. brassicae isolates were divided into two groups. Among them, the DJ, GS, GN, HS, and JS isolates could not infect the CR cultivars. In contrast, the SS, HN1, HN2, PC, and YC isolates caused severe clubroot disease on the CR cultivars like susceptible cultivars. Even though they belong to the same race, the CR cultivars showed a different response to the pathogens. The results suggest that the breakdown of CR in Chinese cabbage has already occurred in cultivation areas of Korea and resistance source introduced in CR cultivars may be very limited. In addition, it is likely that resistance genes of Williams' differential varieties to P. brassicae are different from the gene of CR cultivars of Chinese cabbage used in the study.
Jo, Su-Jung;Jang, Kyoung-Soo;Choi, Yong-Ho;Kim, Jin-Cheol;Choi, Gyung-Ja
Research in Plant Disease
/
v.17
no.2
/
pp.161-168
/
2011
To establish simple and reliable screening method for resistant radish to Plasmodiophora brassicae Woron. using soil-drenching inoculation, the development of clubroot on radish seedlings inoculated with P. brassicae GN-1 isolate according to several conditions such as inoculum concentration, plant growth stage and incubation period after inoculation was studied. To select resistant radish against clubroot, 10-day-old seedlings were inoculated with P. brassicae by drenching the roots with the spore suspension of the pathogen to give $1{\times}10^9$ spores/pot. The inoculated seedlings were incubated in a growth chamber at $20^{\circ}C$ for 3 days then cultivated in a greenhouse ($20{\pm}5^{\circ}C$) for 6 weeks. Under the optimum conditions, 46 commercial cultivars of radish were tested for resistance to YC-1 (infecting 15 clubroot-resistant cultivars of Chinese cabbage) and GN-1 (wild type) isolates of P. brassicae. Among them, thirty-five cultivars showed resistance to both isolates and one cultivar represented susceptible response to the pathogens. On the other hand, the other cultivars showed different responses against the tested P. brassicae pathogens. The results suggest that this method is an efficient system for screening radish with resistance to clubroot.
Ethaboxam[(RS)-N-(a-cyano-2-thenyl)-4-ethyl-2-(ethylamino)-1,3-thiazole-5-carboximide] is a novel fungicide with high level of activity against Oomycetes fungi. The control effects of ethaboxam technical and various ethaboxam formulations were investigated against P. brassicae, the causal agent of clubroot disease in Chinese cabbage. When ethaboxam was applied to infested soil, club formation caused by P. brassicae was strongly inhibited at 8.33 mg/L soil and $EC_{50}$ of ethaboxam was 2.65 mg/L soil. Five ethaboxam formulations [10% suspension concentrate (SC), 15% SC, 2% granule (GR), 5% GR, 25% wettable powder] and mixture formulation of ethaboxam and metalaxyl (3%+1% GR) exhibited good efficacy against the pathogen. 10% SC, 15% SC, and 2% GR formulations of ethaboxam showed better disease controlling efficacy on Chinese cabbage clubroot than the other formulations. The $EC_{50}$ values of 10% SC, 15% SC, and 2% GR formulations of ethaboxam were 3.72 mg AI/L soil, 1.1 mg AI/L soil, and 4.95 mg AI/L soil, respectively. Among them, soil drenching application by 15% SC formulation of ethaboxam exhibited the most in vivo antifungal activity on P. brassicae. These results indicate that ethaboxam has a high potential for the control of clubroot disease.
To investigate control efficacy of flusulfamide GR (granule) on Chinese cabbage clubroot caused by Plasmodiophora brassicae, experiment was accomplished in field located in Gangneungshi alpine area contaminated by P. brassicae. Flusulfamide GR provided control value of 84.6% and that was statistically significant difference from standard fungicides containing untreated control. To investigate ratio of reduction of resting spore according to fungicide treatment, soil of Chinese cabbage field before and after fungicide treatment were sampled and investigated density of resting spore. Resting spore density was not uniform in soil before fungicide treatment. Therefore, to investigate control efficacy of fungicide against clubroot, investigation on resting spore density was conducted before experiment and reflected in experimental design. Flusulfamide GR and DP (dust powder) provided 64.2% and 63.7% of reduction of resting spore on field soil after fungicide treatments. This result indicated that control efficacy of the fungicides was correlated with reduction of resting spore of P. brassicae. The increasing rate in fresh weight of above-ground part of Chinese cabbage by flusulfamide DP and GR, fluazinam DP and trifloxystrobin SC (suspension concentrate) was 14.3%, 13.0%, 13.8% and 3.8%, respectively. From above result, flusulmide GR have outstanding control efficacy against clubroot of Chinese cabbage and is effectively decreasing of resting spore density in soil.
Plasmodiophora brassicae is an obligate parasite, a causal organism of clubroot disease in crucifers that can survive in the soil as resting spores for many years. P. brassicae causes great losses in susceptible varieties of crucifers throughout the world. In this present study, an in planta molecular marker for the detection of P. bassicae was developed using an oligonucleotide primer set foam the small subunit gene (18S like) and internal transcribed spacer (ITS) region of rDNA. The specific primer sequences determined were TCAGCTTGAATGCTAATGTG (ITS5) and CTACCTCATTTGAGATCCTTTGA (PB-2). This primer set was used to specifically detect p. bassicae in planta. The amplicon using the specific primer set was about 1,000 bp. However, the test plant and other soil-borne fungi including Fusarium spp. and Rhizoctonia app., as well as bacteria such as Pseudomonas app. and Erwinia sup. did not show any reaction with the primer set.
Proceedings of the Korean Society of Plant Pathology Conference
/
2003.10a
/
pp.9-12
/
2003
Clubroot disease of curcifer crops caused by Plasmodiophora brassicae had been first reported in 1920 in Korea, and maintained mild occurrence until 1980s. Since 1990s the disease has become severe in alpine areas of Kyonggi and Kangwon, gradually spread to plain fields throughout the country, and remains as the greatest limiting factor for its production. Researches on the disease has begun in late 1990s in our laboratory after experiencing severe epidemics. Survey of occurrence and etiological and ecological studies have been carried out, particularly, on the pathogen physiology, race identification, quantification of soil pathogen population, host spectrum of the pathogen, and control measures.(중략)
DNA amplification by polymerase chain reaction (PCR) was used to specifically detect Plasmodiophora brassicae, causing clubroot of crucifers. On the basis of DNA sequence informations, an oligonucleotide primer set specific for the pathogen was designed form small subunit gene (18S-like) and internal transcribed spacer (ITS) region of ribosomal DNA. Primer ITS 5/PB-C produced an amplification product of approximately 520 bp in length with DNA from P. brassicae. However, no amplification product was produced with DNAs from several soil-borne fungi, Didymella bryoniae and Rhizopus stolonifer. Using these primers, the clubroot pathogen was readily detected from infected roots of crucifers, but not from healthy roots. Southern hybridization analysis further confirmed that the amplification product was originated from P. brassicae.
본 웹사이트에 게시된 이메일 주소가 전자우편 수집 프로그램이나
그 밖의 기술적 장치를 이용하여 무단으로 수집되는 것을 거부하며,
이를 위반시 정보통신망법에 의해 형사 처벌됨을 유념하시기 바랍니다.
[게시일 2004년 10월 1일]
이용약관
제 1 장 총칙
제 1 조 (목적)
이 이용약관은 KoreaScience 홈페이지(이하 “당 사이트”)에서 제공하는 인터넷 서비스(이하 '서비스')의 가입조건 및 이용에 관한 제반 사항과 기타 필요한 사항을 구체적으로 규정함을 목적으로 합니다.
제 2 조 (용어의 정의)
① "이용자"라 함은 당 사이트에 접속하여 이 약관에 따라 당 사이트가 제공하는 서비스를 받는 회원 및 비회원을
말합니다.
② "회원"이라 함은 서비스를 이용하기 위하여 당 사이트에 개인정보를 제공하여 아이디(ID)와 비밀번호를 부여
받은 자를 말합니다.
③ "회원 아이디(ID)"라 함은 회원의 식별 및 서비스 이용을 위하여 자신이 선정한 문자 및 숫자의 조합을
말합니다.
④ "비밀번호(패스워드)"라 함은 회원이 자신의 비밀보호를 위하여 선정한 문자 및 숫자의 조합을 말합니다.
제 3 조 (이용약관의 효력 및 변경)
① 이 약관은 당 사이트에 게시하거나 기타의 방법으로 회원에게 공지함으로써 효력이 발생합니다.
② 당 사이트는 이 약관을 개정할 경우에 적용일자 및 개정사유를 명시하여 현행 약관과 함께 당 사이트의
초기화면에 그 적용일자 7일 이전부터 적용일자 전일까지 공지합니다. 다만, 회원에게 불리하게 약관내용을
변경하는 경우에는 최소한 30일 이상의 사전 유예기간을 두고 공지합니다. 이 경우 당 사이트는 개정 전
내용과 개정 후 내용을 명확하게 비교하여 이용자가 알기 쉽도록 표시합니다.
제 4 조(약관 외 준칙)
① 이 약관은 당 사이트가 제공하는 서비스에 관한 이용안내와 함께 적용됩니다.
② 이 약관에 명시되지 아니한 사항은 관계법령의 규정이 적용됩니다.
제 2 장 이용계약의 체결
제 5 조 (이용계약의 성립 등)
① 이용계약은 이용고객이 당 사이트가 정한 약관에 「동의합니다」를 선택하고, 당 사이트가 정한
온라인신청양식을 작성하여 서비스 이용을 신청한 후, 당 사이트가 이를 승낙함으로써 성립합니다.
② 제1항의 승낙은 당 사이트가 제공하는 과학기술정보검색, 맞춤정보, 서지정보 등 다른 서비스의 이용승낙을
포함합니다.
제 6 조 (회원가입)
서비스를 이용하고자 하는 고객은 당 사이트에서 정한 회원가입양식에 개인정보를 기재하여 가입을 하여야 합니다.
제 7 조 (개인정보의 보호 및 사용)
당 사이트는 관계법령이 정하는 바에 따라 회원 등록정보를 포함한 회원의 개인정보를 보호하기 위해 노력합니다. 회원 개인정보의 보호 및 사용에 대해서는 관련법령 및 당 사이트의 개인정보 보호정책이 적용됩니다.
제 8 조 (이용 신청의 승낙과 제한)
① 당 사이트는 제6조의 규정에 의한 이용신청고객에 대하여 서비스 이용을 승낙합니다.
② 당 사이트는 아래사항에 해당하는 경우에 대해서 승낙하지 아니 합니다.
- 이용계약 신청서의 내용을 허위로 기재한 경우
- 기타 규정한 제반사항을 위반하며 신청하는 경우
제 9 조 (회원 ID 부여 및 변경 등)
① 당 사이트는 이용고객에 대하여 약관에 정하는 바에 따라 자신이 선정한 회원 ID를 부여합니다.
② 회원 ID는 원칙적으로 변경이 불가하며 부득이한 사유로 인하여 변경 하고자 하는 경우에는 해당 ID를
해지하고 재가입해야 합니다.
③ 기타 회원 개인정보 관리 및 변경 등에 관한 사항은 서비스별 안내에 정하는 바에 의합니다.
제 3 장 계약 당사자의 의무
제 10 조 (KISTI의 의무)
① 당 사이트는 이용고객이 희망한 서비스 제공 개시일에 특별한 사정이 없는 한 서비스를 이용할 수 있도록
하여야 합니다.
② 당 사이트는 개인정보 보호를 위해 보안시스템을 구축하며 개인정보 보호정책을 공시하고 준수합니다.
③ 당 사이트는 회원으로부터 제기되는 의견이나 불만이 정당하다고 객관적으로 인정될 경우에는 적절한 절차를
거쳐 즉시 처리하여야 합니다. 다만, 즉시 처리가 곤란한 경우는 회원에게 그 사유와 처리일정을 통보하여야
합니다.
제 11 조 (회원의 의무)
① 이용자는 회원가입 신청 또는 회원정보 변경 시 실명으로 모든 사항을 사실에 근거하여 작성하여야 하며,
허위 또는 타인의 정보를 등록할 경우 일체의 권리를 주장할 수 없습니다.
② 당 사이트가 관계법령 및 개인정보 보호정책에 의거하여 그 책임을 지는 경우를 제외하고 회원에게 부여된
ID의 비밀번호 관리소홀, 부정사용에 의하여 발생하는 모든 결과에 대한 책임은 회원에게 있습니다.
③ 회원은 당 사이트 및 제 3자의 지적 재산권을 침해해서는 안 됩니다.
제 4 장 서비스의 이용
제 12 조 (서비스 이용 시간)
① 서비스 이용은 당 사이트의 업무상 또는 기술상 특별한 지장이 없는 한 연중무휴, 1일 24시간 운영을
원칙으로 합니다. 단, 당 사이트는 시스템 정기점검, 증설 및 교체를 위해 당 사이트가 정한 날이나 시간에
서비스를 일시 중단할 수 있으며, 예정되어 있는 작업으로 인한 서비스 일시중단은 당 사이트 홈페이지를
통해 사전에 공지합니다.
② 당 사이트는 서비스를 특정범위로 분할하여 각 범위별로 이용가능시간을 별도로 지정할 수 있습니다. 다만
이 경우 그 내용을 공지합니다.
제 13 조 (홈페이지 저작권)
① NDSL에서 제공하는 모든 저작물의 저작권은 원저작자에게 있으며, KISTI는 복제/배포/전송권을 확보하고
있습니다.
② NDSL에서 제공하는 콘텐츠를 상업적 및 기타 영리목적으로 복제/배포/전송할 경우 사전에 KISTI의 허락을
받아야 합니다.
③ NDSL에서 제공하는 콘텐츠를 보도, 비평, 교육, 연구 등을 위하여 정당한 범위 안에서 공정한 관행에
합치되게 인용할 수 있습니다.
④ NDSL에서 제공하는 콘텐츠를 무단 복제, 전송, 배포 기타 저작권법에 위반되는 방법으로 이용할 경우
저작권법 제136조에 따라 5년 이하의 징역 또는 5천만 원 이하의 벌금에 처해질 수 있습니다.
제 14 조 (유료서비스)
① 당 사이트 및 협력기관이 정한 유료서비스(원문복사 등)는 별도로 정해진 바에 따르며, 변경사항은 시행 전에
당 사이트 홈페이지를 통하여 회원에게 공지합니다.
② 유료서비스를 이용하려는 회원은 정해진 요금체계에 따라 요금을 납부해야 합니다.
제 5 장 계약 해지 및 이용 제한
제 15 조 (계약 해지)
회원이 이용계약을 해지하고자 하는 때에는 [가입해지] 메뉴를 이용해 직접 해지해야 합니다.
제 16 조 (서비스 이용제한)
① 당 사이트는 회원이 서비스 이용내용에 있어서 본 약관 제 11조 내용을 위반하거나, 다음 각 호에 해당하는
경우 서비스 이용을 제한할 수 있습니다.
- 2년 이상 서비스를 이용한 적이 없는 경우
- 기타 정상적인 서비스 운영에 방해가 될 경우
② 상기 이용제한 규정에 따라 서비스를 이용하는 회원에게 서비스 이용에 대하여 별도 공지 없이 서비스 이용의
일시정지, 이용계약 해지 할 수 있습니다.
제 17 조 (전자우편주소 수집 금지)
회원은 전자우편주소 추출기 등을 이용하여 전자우편주소를 수집 또는 제3자에게 제공할 수 없습니다.
제 6 장 손해배상 및 기타사항
제 18 조 (손해배상)
당 사이트는 무료로 제공되는 서비스와 관련하여 회원에게 어떠한 손해가 발생하더라도 당 사이트가 고의 또는 과실로 인한 손해발생을 제외하고는 이에 대하여 책임을 부담하지 아니합니다.
제 19 조 (관할 법원)
서비스 이용으로 발생한 분쟁에 대해 소송이 제기되는 경우 민사 소송법상의 관할 법원에 제기합니다.
[부 칙]
1. (시행일) 이 약관은 2016년 9월 5일부터 적용되며, 종전 약관은 본 약관으로 대체되며, 개정된 약관의 적용일 이전 가입자도 개정된 약관의 적용을 받습니다.