• Journal of Microbiology and Biotechnology
• /
• 제30권12호
• /
• pp.1876-1884
• /
• 2020

Ethanol often accumulates during the process of wine fermentation, and mitophagy has critical role in ethanol output. However, the relationship between mitophagy and ethanol stress is still unclear. In this study, the expression of ATG11 and ATG32 genes exposed to ethanol stress was accessed by real-time quantitative reverse transcription polymerase chain reaction (qRT-PCR). The result indicated that ethanol stress induced expression of the ATG11 and ATG32 genes. The colony sizes and the alcohol yield of atg11 and atg32 were also smaller and lower than those of wild type strain under ethanol whereas the mortality of mutants is higher. Furthermore, compared with wild type, the membrane integrity and the mitochondrial membrane potential of atg11 and atg32 exhibited greater damage following ethanol stress. In addition, a greater proportion of mutant cells were arrested at the G1/G0 cell cycle. There was more aggregation of peroxide hydrogen (H2O2) and superoxide anion (O2•-) in mutants. These changes in H2O2 and O2•- in yeasts were altered by reductants or inhibitors of scavenging enzyme by means of regulating the expression of ATG11 and ATG32 genes. Inhibitors of the mitochondrial electron transport chain (mtETC) also increased production of H2O2 and O2•- by enhancing expression of the ATG11 and ATG32 genes. Further results showed that activator or inhibitor of autophagy also activated or inhibited mitophagy by altering production of H2O2 and O2•. Therefore, ethanol stress induces mitophagy which improves yeast the tolerance to ethanol and the level of mitophagy during ethanol stress is regulated by ROS derived from mtETC.

• Molecules and Cells
• /
• 제41권1호
• /
• pp.35-44
• /
• 2018

Mitochondria are responsible for supplying of most of the cell's energy via oxidative phosphorylation. However, mitochondria also can be deleterious for a cell because they are the primary source of reactive oxygen species, which are generated as a byproduct of respiration. Accumulation of mitochondrial and cellular oxidative damage leads to diverse pathologies. Thus, it is important to maintain a population of healthy and functional mitochondria for normal cellular metabolism. Eukaryotes have developed defense mechanisms to cope with aberrant mitochondria. Mitochondria autophagy (known as mitophagy) is thought to be one such process that selectively sequesters dysfunctional or excess mitochondria within double-membrane autophagosomes and carries them into lysosomes/vacuoles for degradation. The power of genetics and conservation of fundamental cellular processes among eukaryotes make yeast an excellent model for understanding the general mechanisms, regulation, and function of mitophagy. In budding yeast, a mitochondrial surface protein, Atg32, serves as a mitochondrial receptor for selective autophagy that interacts with Atg11, an adaptor protein for selective types of autophagy, and Atg8, a ubiquitin-like protein localized to the isolation membrane. Atg32 is regulated transcriptionally and post-translationally to control mitophagy. Moreover, because Atg32 is a mitophagy-specific protein, analysis of its deficient mutant enables investigation of the physiological roles of mitophagy. Here, we review recent progress in the understanding of the molecular mechanisms and functional importance of mitophagy in yeast at multiple levels.

• 생명과학회지
• /
• 제7권3호
• /
• pp.167-171
• /
• 1997

번역개시 및 인산화의 조절에 관여하는 RNA와 단백질의 결합 및 인식기작을 연구하기 위해서[$\alpha$^{-32}$P] UMP-labeled HIV Rev-responsive element(RRE) RNA를 이용한 affinity screening에 이해서 Hela ZA-PII cDNA library로부터 이중선RNA결합단백질의 cDNA (RBFII)를 분리하였다. RBFII의 cDNA에 대한 염기서열을 결정하였으며 기존에 연구된 바 있는 RBFII(RBF 또는 TRBP로 보고되었으며 본 연구에서는 RBFII와 구분하기 위해 RBFI으로 명명)과 대부분의 경우 공통적인 ORF를 지니는 것으로 나타났다. 그러나 5’말단에서는 공통적인 ORF 가 RBFI의 경우 21개의 아미노산을 의미하는 63 nt가 Lac-Z의 N-말단에 연결된데 비해서 특이한 46개 아미노기를 의미하는 138nt가 존재함이 밝혀졌다. 5’-말단에 처음 나타나는 ATG 및 부근의 염기서열을 분석해 볼 때 양 cDNA는 5’말단이 완전하지 않은 것으로 사료된다.

• 미생물학회지
• /
• 제24권3호
• /
• pp.204-210
• /
• 1986

One clone(pANt32) carring tRNA/sup Arg/ gene was selected from Aspergillus total tRNA gene clones. The nucleotide sequences of this tRNA gene were determined by Maxam and Gilbert's chemical cleavage methods. The sequence of this tRNA gene is as follow; 5'GGCCGGCTGCCCAATTGGCAAGGCGTCTGACTACGAATCAGGAGAT TGCAGGTTCGAGCCCTGCGTGGGTCA3'. This sequence conicides with the characteristecs of other eukaryotic tRNA. Some consensus sequences (ACT-TA bow, TATTTT and T-cluster) are found in both 5'-end and 3'-end flanking regions.

• Asian-Australasian Journal of Animal Sciences
• /
• 제32권4호
• /
• pp.592-598
• /
• 2019

Objective: Autophagy is a bulk degradation system for intracellular proteins which contributes to skeletal muscle homeostasis, according to previous studies in humans and rodents. However, there is a lack of information on the physiological role of autophagy in the skeletal muscle of meat animals. This study was planned as a pilot study to investigate changes in expression of two major autophagy-related genes, microtubule-associated protein 1 light chain $3{\beta}$ (MAP1LC3B) and autophagy related 7 (ATG7) in fattening beef cattle, and to compare them with skeletal muscle growth. Methods: Six castrated Japanese Black cattle (initial body weight: $503{\pm}20kg$) were enrolled in this study and fattened for 7 months. Three skeletal muscles, M. longissimus, M. gluteus medius, and M. semimembranosus, were collected by needle biopsy three times during the observation period, and mRNA levels of MAP1LC3B and ATG7 were determined by quantitative reverse-transcription polymerase chain reaction. The expression levels of genes associated with the ubiquitin-proteasome system, another proteolytic mechanism, were also analyzed for comparison with autophagy-related genes. In addition, ultrasonic scanning was repeatedly performed to measure M. longissimus area as an index of muscle growth. Results: Our results showed that both MAP1LC3B and ATG7 expression increased over the observation period in all three skeletal muscles. Interestingly, the increase in expression of these two genes in M. longissimus was highly correlated with ultrasonic M. longissimus area and body weight. On the other hand, the expression of genes associated with the ubiquitin-proteasome system was unchanged during the same period. Conclusion: These findings suggest that autophagy plays an important role in the growth of skeletal muscle of fattening beef cattle and imply that autophagic activity affects meat productivity.

• BMB Reports
• /
• 제32권5호
• /
• pp.436-439
• /
• 1999

Shigella sonnei is an important cause of human enteric infections. S. sonnei KNIH104S was previously reported to be isolated from Korean shigellosis patients. We cloned a 2.8-kb KpnI fragment containing the recA gene encoding a recombinase from the chromosomal DNA of S. sonnei KNIH104S. This recombinant plasmid was named pRAK28. E. coli HB101, a recA mutant, cannot grow on Luria-Bertani medium in the presence of the alkylating agent methylmethane sulfonate, however, E. coli HB101 harboring pRAK28 was found to grow on this medium. As far as we know, we are the first to sequence the recA gene from S. sonnei. This gene is composed of 1062 base pairs with an ATG initiation codon and a TAA termination codon. Nucleotide sequence comparison of the S. sonnei recA gene exhibited 99.7% and 99.5% identity with those of S. flexneri and E. coli, respectively.

• 한국어병학회지
• /
• 제8권1호
• /
• pp.37-46
• /
• 1995

H. cunea nuclear polyhedrosis virus (HcNPV) 의 polyhedrin 아미노산 및 polyhedrin gene 의 염기서열을 분석하였다. Polyhedrin 은 SDS-PAGE 상에서 3개의 polypeptide band 가 나타났고 주요 polypeptide 는 약 25 Kd 의 분자량을 갖고 있었다. 또한 polyhedrin 은 17 개의 다른 아미노산으로 구성되어 있었다. HcNPV DNA를 EcoRI 효소로 절단하여 $\alpha^{32}P$로 labelling 된 Autographa californica (AcNPV) polyhedrin gene cDNA 의 probe DNA를 이용하여 hybridization 한 결과 polyhedrin gene은 EcoRI 절편들중 H 절편에 양성반응을 나타냈다. 또한 polyhedrin gene 을 포함하고 있는 EcoRI-H 절편을 pUC8 벡터에 cloning한 다음 이를 hPE-H라고 이름하였다. HcNPV genome DNA 의 promoter 부위를 sequence한 결과 TATA box의 염기배열은 polyhedrin gene 전사 개시위치로부터 위쪽으로 -79 bp 의 5' flanking 부위에서 발견되었다. polyhedrin gene 내 CAAT box는 TATA box 측면 염기 배열에서 나타나지 않았고, 4개의 tandem repeat 5'-CTAATAT-3' 와 5'-TAAATAA-3'의 염기는 polyhedrin gene내 전이 개시 위치로 부터 위쪽으로 -141 과 -108 bp 또는 -83 bp 부위에 존재하였으며, 다른 하나는 전이 개시위치로 부터 아래쪽으로 -52 bp 부위에서 발견되었다. 그리고 polyhedrin gene 내 전이 개시위치로 부터 위쪽으로 -141 bp 부위는 다량의 AT (78%) 염기가 존재하였다. 또한 polyhedrin 의 개시 coding region 은 ATG 였고 종결 coding region은 TAA 였다.

• 생명과학회지
• /
• 제21권3호
• /
• pp.400-405
• /
• 2011

Autophagy는 항상성 유지와 스트레스반응을 효율적으로 조정하기 위해 필수적인 세포 내 질적 조절작용이다. 노화가 진행되는 동안 autopahgy에 의한 degradation 효율성 저하와 그로 인한 세포 내 부산물의 축적이 증가하여 결국, 근육의 약화를 초래한다. 그러므로 본 연구의 목적은 골격근에서 운동에 의한 autopahgy 관련 단백질의 변화를 규명하는데 있다. 이를 위해 24마리의 Young 그룹과 Old 그룹을 나누어 각각 대조군(n=6)과 운동군(n=6)으로 배정하였다. 운동은 8주간 주 5회 실시하였고, 트레드밀 속도 16.4 m/min와 경사도 4%로 설정하여 40분간 지속적인 운동을 실시하였다. autopahgy 관련 단백질에 대한 검증 결과 Young 그룹과 비교하여 Old 그룹에서 LC3-1, Beclin-1, Atg7은 모두 유의하게 감소하였다. 그러나 8주간의 규칙적인 운동에 의하여 autophagy 관련 단백질은 증가하는 것으로 나타났다. 따라서 노화에 의해 약화된 autopahgy 기능은 규칙적인 운동에 의해 개선될 수 있을 것으로 사료된다.

• Tuberculosis and Respiratory Diseases
• /
• 제80권3호
• /
• pp.270-276
• /
• 2017

Background: A disputed rpoB mutation is a specific type of rpoB mutation that can cause low-level resistances to rifampin (RIF). Here, we aimed to assess the frequency and types of disputed rpoB mutations in Mycobacterium tuberculosis isolates from South Korea. Methods: Between August 2009 and December 2015, 130 patients exhibited RIF resistance on the MTBDRplus assay at Asan Medical Center. Among these cases, we identified the strains with disputed rpoB mutation by rpoB sequencing analysis, as well as among the M. tuberculosis strains from the International Tuberculosis Research Center (ITRC). Results: Among our cases, disputed rpoB mutations led to RIF resistance in at least 6.9% (9/130) of the strains that also exhibited RIF resistance on the MTBDRplus assay. Moreover, at the ITRC, sequencing of the rpoB gene of 170 strains with the rpoB mutation indicated that 23 strains (13.5%) had the disputed mutations. By combining the findings from the 32 strains from our center and the ITRC, we identified the type of disputed rpoB mutation as follows: CTG511CCG (L511P, n=8), GAC516TAC (D516Y, n=8), CTG533CCG (L533P, n=8), CAC526CTC (H526L, n=4), CAC526AAC (H526N, n=3), and ATG515GTG (M515V, n=1). Conclusion: Disputed rpoB mutations do not seem to be rare among the strains exhibiting RIF resistance in South Korea.

• 미생물학회지
• /
• 제32권3호
• /
• pp.215-221
• /
• 1994

Bacillus megaterium ATCC 14945의 penicillin G acylase 유전자의 염기배열을 결정하였다. 이 유전자에는 2,406 염기쌍으로 이루어진 하나의 open reading frame이 존재하는데, 개시코돈의 5' 위쪽에서 Shine-Dalgarno 배열과 promoter로 여겨지는 부분을 발견하였으며, 종결코돈의 3' 아래쪽에서 rho-independent한 전사종결체와 dby사한 구조를 발견하였다. 염기배열로부터 폴리펩티드의 아미노산 배열을 유추하였다. 이 폴리펩티드의 분자량은 91,983 Da이었으며, 아미노 말단 부이에 signal sequence가 존재하였다. 이 아미노산 배열을 여러 다른 penicillin G acylase의 아미노산 배열과 비교하고 분리 정제한 효소를 SDS-polyacrylamide gel 전기영동으로 분석한 결과로부터 이 효소는 92kDa의 전구체로 해독된 후 processing 과정을 거쳐 각각 25kDa과 61kDa의 ${\alpha}$-, ${\beta}$-단위체로 구성됨을 알 수 있었다.