Ethanol often accumulates during the process of wine fermentation, and mitophagy has critical role in ethanol output. However, the relationship between mitophagy and ethanol stress is still unclear. In this study, the expression of ATG11 and ATG32 genes exposed to ethanol stress was accessed by real-time quantitative reverse transcription polymerase chain reaction (qRT-PCR). The result indicated that ethanol stress induced expression of the ATG11 and ATG32 genes. The colony sizes and the alcohol yield of atg11 and atg32 were also smaller and lower than those of wild type strain under ethanol whereas the mortality of mutants is higher. Furthermore, compared with wild type, the membrane integrity and the mitochondrial membrane potential of atg11 and atg32 exhibited greater damage following ethanol stress. In addition, a greater proportion of mutant cells were arrested at the G1/G0 cell cycle. There was more aggregation of peroxide hydrogen (H2O2) and superoxide anion (O2•-) in mutants. These changes in H2O2 and O2•- in yeasts were altered by reductants or inhibitors of scavenging enzyme by means of regulating the expression of ATG11 and ATG32 genes. Inhibitors of the mitochondrial electron transport chain (mtETC) also increased production of H2O2 and O2•- by enhancing expression of the ATG11 and ATG32 genes. Further results showed that activator or inhibitor of autophagy also activated or inhibited mitophagy by altering production of H2O2 and O2•. Therefore, ethanol stress induces mitophagy which improves yeast the tolerance to ethanol and the level of mitophagy during ethanol stress is regulated by ROS derived from mtETC.
Mitochondria are responsible for supplying of most of the cell's energy via oxidative phosphorylation. However, mitochondria also can be deleterious for a cell because they are the primary source of reactive oxygen species, which are generated as a byproduct of respiration. Accumulation of mitochondrial and cellular oxidative damage leads to diverse pathologies. Thus, it is important to maintain a population of healthy and functional mitochondria for normal cellular metabolism. Eukaryotes have developed defense mechanisms to cope with aberrant mitochondria. Mitochondria autophagy (known as mitophagy) is thought to be one such process that selectively sequesters dysfunctional or excess mitochondria within double-membrane autophagosomes and carries them into lysosomes/vacuoles for degradation. The power of genetics and conservation of fundamental cellular processes among eukaryotes make yeast an excellent model for understanding the general mechanisms, regulation, and function of mitophagy. In budding yeast, a mitochondrial surface protein, Atg32, serves as a mitochondrial receptor for selective autophagy that interacts with Atg11, an adaptor protein for selective types of autophagy, and Atg8, a ubiquitin-like protein localized to the isolation membrane. Atg32 is regulated transcriptionally and post-translationally to control mitophagy. Moreover, because Atg32 is a mitophagy-specific protein, analysis of its deficient mutant enables investigation of the physiological roles of mitophagy. Here, we review recent progress in the understanding of the molecular mechanisms and functional importance of mitophagy in yeast at multiple levels.
As an initial effort to elucidate RNA: protein binding in a way to regulate translation initiation and phosphorylation, a cDNA encoding a double-stranded RNA binding factor (RBFII)was isolated from Hela ZAPII cDNA library by affinity screening using [$\alpha$$^{-32}$P] UMP-labeled HIV Rev-responsive element(RRE) RNA. The nucleotide sequence of RBF (or TRBP) cDNA except the 5’end. At the 5’end, This common ORF was fused in-frame to N-terminal residues of Lac-Z through a unique 138 nt sequence encoding 46residues in the case of RBFII and a 63 nt sequence encoding 21 residuces in the case of RBFI. The context of ATG appearing first in the sequences suggests that both these cDNA inserts are incomplete at the 5’end.
One clone(pANt32) carring tRNA/sup Arg/ gene was selected from Aspergillus total tRNA gene clones. The nucleotide sequences of this tRNA gene were determined by Maxam and Gilbert's chemical cleavage methods. The sequence of this tRNA gene is as follow; 5'GGCCGGCTGCCCAATTGGCAAGGCGTCTGACTACGAATCAGGAGAT TGCAGGTTCGAGCCCTGCGTGGGTCA3'. This sequence conicides with the characteristecs of other eukaryotic tRNA. Some consensus sequences (ACT-TA bow, TATTTT and T-cluster) are found in both 5'-end and 3'-end flanking regions.
Objective: Autophagy is a bulk degradation system for intracellular proteins which contributes to skeletal muscle homeostasis, according to previous studies in humans and rodents. However, there is a lack of information on the physiological role of autophagy in the skeletal muscle of meat animals. This study was planned as a pilot study to investigate changes in expression of two major autophagy-related genes, microtubule-associated protein 1 light chain $3{\beta}$ (MAP1LC3B) and autophagy related 7 (ATG7) in fattening beef cattle, and to compare them with skeletal muscle growth. Methods: Six castrated Japanese Black cattle (initial body weight: $503{\pm}20kg$) were enrolled in this study and fattened for 7 months. Three skeletal muscles, M. longissimus, M. gluteus medius, and M. semimembranosus, were collected by needle biopsy three times during the observation period, and mRNA levels of MAP1LC3B and ATG7 were determined by quantitative reverse-transcription polymerase chain reaction. The expression levels of genes associated with the ubiquitin-proteasome system, another proteolytic mechanism, were also analyzed for comparison with autophagy-related genes. In addition, ultrasonic scanning was repeatedly performed to measure M. longissimus area as an index of muscle growth. Results: Our results showed that both MAP1LC3B and ATG7 expression increased over the observation period in all three skeletal muscles. Interestingly, the increase in expression of these two genes in M. longissimus was highly correlated with ultrasonic M. longissimus area and body weight. On the other hand, the expression of genes associated with the ubiquitin-proteasome system was unchanged during the same period. Conclusion: These findings suggest that autophagy plays an important role in the growth of skeletal muscle of fattening beef cattle and imply that autophagic activity affects meat productivity.
Shigella sonnei is an important cause of human enteric infections. S. sonnei KNIH104S was previously reported to be isolated from Korean shigellosis patients. We cloned a 2.8-kb KpnI fragment containing the recA gene encoding a recombinase from the chromosomal DNA of S. sonnei KNIH104S. This recombinant plasmid was named pRAK28. E. coli HB101, a recA mutant, cannot grow on Luria-Bertani medium in the presence of the alkylating agent methylmethane sulfonate, however, E. coli HB101 harboring pRAK28 was found to grow on this medium. As far as we know, we are the first to sequence the recA gene from S. sonnei. This gene is composed of 1062 base pairs with an ATG initiation codon and a TAA termination codon. Nucleotide sequence comparison of the S. sonnei recA gene exhibited 99.7% and 99.5% identity with those of S. flexneri and E. coli, respectively.
The amino acid analysis of polyhedrin protein and nucleotide sequence of polyhedrin gene in H. cunea nuclear polyhedrosis virus (HcNPV) genome have been studied. Polyhedrin had three polypeptide bands in SDS - polyactylamide gel electrophoresis. The major polypeptide had a molecular weight of 25 kd. The polyhedrin was composed of 17 different amino acids. HcNPV DNA was digested with EcoRI restriction enzyme and hybridized with ($\alpha^{32}P$) -labelled AcNPV polyhedrin gene cDNA. The polyhedrin gene was located on the fragment of EcoRI-H. The EcoRI - H fragment containing polyhedrin gene was cloned into the EcoRI site of pUC8 vector which was confirmed with southern blotting, and the recombinant plasmid containg polyhedrin gene was designated as hPE-H. The promoter region of polyhedrin genomic DNA was sequenced. The sequences identified as the TATA box was found at the 5' flanking region of the polyhedrin genomic DNA approximately -79 bp upstream from the transcriptional start site. But CAAT-like box was not shown near the TATA-like box in the polyhedrin gene. Four tandem repeats with the sequence 5' -CTAATAT-3' and 5'-TAAATAA-3' were found between -141 and -108 or -83 upstream and -52 bp downstream from the translation start site. About -141 bp region upstream from the translational start site was highly AT (78%) rich. The coding region for the polyhedrin starts and ends with ATG and TAA, respectively.
Autophagy, a highly conserved mechanism of internal quality control, is essential for the maintenance of cellular homeostasis and for the orchestration of an efficient cellular response to stress. During aging, the efficiency of autophagic degradation declines and intracellular waste products accumulate. Therefore, the aim of this study is to investigate the effects of exercise on autophagic response in skeletal muscle. Twenty-four Young (4 month) and Old (12 month) ICR-type white male mice were divided into a control group (CON: n=6) and exercise training group (Tr: n=6) after an adaptation period of 1 week. Exercise consisted of treadmill running at 16.4 m/min with a 4% incline, 40 min/day and 5 days/week for 8 weeks. Cervical dislocation was performed at 48 hours after the last round of exercise, after which the gastrocnemius skeletal muscle were immediately collected. The results of verifying autophagy formation showed that the Sarcopenia index was decreased in the Old mice compared to the Young. However, it increased with exercise training in the Old. Lipidation LC3-II, Becline-1, and Atg7 were decreased in the Old mice compared to the Young. However, Lipidation LC3-II was significantly increased in the trained Old mice (Young:1 Vs Old:$1.32{\pm}0.042$, p<0.05). Based on these data, we suggest that autophagy regulatory events are the attenuated in Old mice, but that they are enhanced with exercise training.
Jo, Kyung-Wook;Lee, Soyeon;Kang, Mi Ran;Sung, Heungsup;Kim, Mi-Na;Shim, Tae Sun
Tuberculosis and Respiratory Diseases
/
v.80
no.3
/
pp.270-276
/
2017
Background: A disputed rpoB mutation is a specific type of rpoB mutation that can cause low-level resistances to rifampin (RIF). Here, we aimed to assess the frequency and types of disputed rpoB mutations in Mycobacterium tuberculosis isolates from South Korea. Methods: Between August 2009 and December 2015, 130 patients exhibited RIF resistance on the MTBDRplus assay at Asan Medical Center. Among these cases, we identified the strains with disputed rpoB mutation by rpoB sequencing analysis, as well as among the M. tuberculosis strains from the International Tuberculosis Research Center (ITRC). Results: Among our cases, disputed rpoB mutations led to RIF resistance in at least 6.9% (9/130) of the strains that also exhibited RIF resistance on the MTBDRplus assay. Moreover, at the ITRC, sequencing of the rpoB gene of 170 strains with the rpoB mutation indicated that 23 strains (13.5%) had the disputed mutations. By combining the findings from the 32 strains from our center and the ITRC, we identified the type of disputed rpoB mutation as follows: CTG511CCG (L511P, n=8), GAC516TAC (D516Y, n=8), CTG533CCG (L533P, n=8), CAC526CTC (H526L, n=4), CAC526AAC (H526N, n=3), and ATG515GTG (M515V, n=1). Conclusion: Disputed rpoB mutations do not seem to be rare among the strains exhibiting RIF resistance in South Korea.
The complete nucleotide sequence of the cloned pga gene encoding the penicillin G acylase of Bacillus megaterium ATCC 14945 and its 5'- and 3'-flanking regions was determined. The sequence revealed only one large open reading frame (2,406 hp) of the penicillin G acylase (pga) gene. Upstream from ATG of the pga gene, there was a putative ribosome binding site, Shine-Dalgarno sequence. The promoter-like structure, - 10 and - 35 sequences, was also found. Following the stop codon, TAG, a structure reminiscent of the E. coli rho-independent transcription terminator was present. The amino acid sequence was deduced from the nucleotide sequence. The molecular mass of the polypeptide was 91,983 Da. There was a potential signal sequence in its amino-terminal region. A comparison of its deduced amino acid sequence with other characterized penicillin G acylases and the result of SDS-polyacrylamide gel electrophoresis of the purified enzyme showed that a precursor polypeptide of 92 kDa was processed into two dissimilar ${\alpha}$ and ${\beta}$-subunits of 25 and 61 kDa.
본 웹사이트에 게시된 이메일 주소가 전자우편 수집 프로그램이나
그 밖의 기술적 장치를 이용하여 무단으로 수집되는 것을 거부하며,
이를 위반시 정보통신망법에 의해 형사 처벌됨을 유념하시기 바랍니다.
[게시일 2004년 10월 1일]
이용약관
제 1 장 총칙
제 1 조 (목적)
이 이용약관은 KoreaScience 홈페이지(이하 “당 사이트”)에서 제공하는 인터넷 서비스(이하 '서비스')의 가입조건 및 이용에 관한 제반 사항과 기타 필요한 사항을 구체적으로 규정함을 목적으로 합니다.
제 2 조 (용어의 정의)
① "이용자"라 함은 당 사이트에 접속하여 이 약관에 따라 당 사이트가 제공하는 서비스를 받는 회원 및 비회원을
말합니다.
② "회원"이라 함은 서비스를 이용하기 위하여 당 사이트에 개인정보를 제공하여 아이디(ID)와 비밀번호를 부여
받은 자를 말합니다.
③ "회원 아이디(ID)"라 함은 회원의 식별 및 서비스 이용을 위하여 자신이 선정한 문자 및 숫자의 조합을
말합니다.
④ "비밀번호(패스워드)"라 함은 회원이 자신의 비밀보호를 위하여 선정한 문자 및 숫자의 조합을 말합니다.
제 3 조 (이용약관의 효력 및 변경)
① 이 약관은 당 사이트에 게시하거나 기타의 방법으로 회원에게 공지함으로써 효력이 발생합니다.
② 당 사이트는 이 약관을 개정할 경우에 적용일자 및 개정사유를 명시하여 현행 약관과 함께 당 사이트의
초기화면에 그 적용일자 7일 이전부터 적용일자 전일까지 공지합니다. 다만, 회원에게 불리하게 약관내용을
변경하는 경우에는 최소한 30일 이상의 사전 유예기간을 두고 공지합니다. 이 경우 당 사이트는 개정 전
내용과 개정 후 내용을 명확하게 비교하여 이용자가 알기 쉽도록 표시합니다.
제 4 조(약관 외 준칙)
① 이 약관은 당 사이트가 제공하는 서비스에 관한 이용안내와 함께 적용됩니다.
② 이 약관에 명시되지 아니한 사항은 관계법령의 규정이 적용됩니다.
제 2 장 이용계약의 체결
제 5 조 (이용계약의 성립 등)
① 이용계약은 이용고객이 당 사이트가 정한 약관에 「동의합니다」를 선택하고, 당 사이트가 정한
온라인신청양식을 작성하여 서비스 이용을 신청한 후, 당 사이트가 이를 승낙함으로써 성립합니다.
② 제1항의 승낙은 당 사이트가 제공하는 과학기술정보검색, 맞춤정보, 서지정보 등 다른 서비스의 이용승낙을
포함합니다.
제 6 조 (회원가입)
서비스를 이용하고자 하는 고객은 당 사이트에서 정한 회원가입양식에 개인정보를 기재하여 가입을 하여야 합니다.
제 7 조 (개인정보의 보호 및 사용)
당 사이트는 관계법령이 정하는 바에 따라 회원 등록정보를 포함한 회원의 개인정보를 보호하기 위해 노력합니다. 회원 개인정보의 보호 및 사용에 대해서는 관련법령 및 당 사이트의 개인정보 보호정책이 적용됩니다.
제 8 조 (이용 신청의 승낙과 제한)
① 당 사이트는 제6조의 규정에 의한 이용신청고객에 대하여 서비스 이용을 승낙합니다.
② 당 사이트는 아래사항에 해당하는 경우에 대해서 승낙하지 아니 합니다.
- 이용계약 신청서의 내용을 허위로 기재한 경우
- 기타 규정한 제반사항을 위반하며 신청하는 경우
제 9 조 (회원 ID 부여 및 변경 등)
① 당 사이트는 이용고객에 대하여 약관에 정하는 바에 따라 자신이 선정한 회원 ID를 부여합니다.
② 회원 ID는 원칙적으로 변경이 불가하며 부득이한 사유로 인하여 변경 하고자 하는 경우에는 해당 ID를
해지하고 재가입해야 합니다.
③ 기타 회원 개인정보 관리 및 변경 등에 관한 사항은 서비스별 안내에 정하는 바에 의합니다.
제 3 장 계약 당사자의 의무
제 10 조 (KISTI의 의무)
① 당 사이트는 이용고객이 희망한 서비스 제공 개시일에 특별한 사정이 없는 한 서비스를 이용할 수 있도록
하여야 합니다.
② 당 사이트는 개인정보 보호를 위해 보안시스템을 구축하며 개인정보 보호정책을 공시하고 준수합니다.
③ 당 사이트는 회원으로부터 제기되는 의견이나 불만이 정당하다고 객관적으로 인정될 경우에는 적절한 절차를
거쳐 즉시 처리하여야 합니다. 다만, 즉시 처리가 곤란한 경우는 회원에게 그 사유와 처리일정을 통보하여야
합니다.
제 11 조 (회원의 의무)
① 이용자는 회원가입 신청 또는 회원정보 변경 시 실명으로 모든 사항을 사실에 근거하여 작성하여야 하며,
허위 또는 타인의 정보를 등록할 경우 일체의 권리를 주장할 수 없습니다.
② 당 사이트가 관계법령 및 개인정보 보호정책에 의거하여 그 책임을 지는 경우를 제외하고 회원에게 부여된
ID의 비밀번호 관리소홀, 부정사용에 의하여 발생하는 모든 결과에 대한 책임은 회원에게 있습니다.
③ 회원은 당 사이트 및 제 3자의 지적 재산권을 침해해서는 안 됩니다.
제 4 장 서비스의 이용
제 12 조 (서비스 이용 시간)
① 서비스 이용은 당 사이트의 업무상 또는 기술상 특별한 지장이 없는 한 연중무휴, 1일 24시간 운영을
원칙으로 합니다. 단, 당 사이트는 시스템 정기점검, 증설 및 교체를 위해 당 사이트가 정한 날이나 시간에
서비스를 일시 중단할 수 있으며, 예정되어 있는 작업으로 인한 서비스 일시중단은 당 사이트 홈페이지를
통해 사전에 공지합니다.
② 당 사이트는 서비스를 특정범위로 분할하여 각 범위별로 이용가능시간을 별도로 지정할 수 있습니다. 다만
이 경우 그 내용을 공지합니다.
제 13 조 (홈페이지 저작권)
① NDSL에서 제공하는 모든 저작물의 저작권은 원저작자에게 있으며, KISTI는 복제/배포/전송권을 확보하고
있습니다.
② NDSL에서 제공하는 콘텐츠를 상업적 및 기타 영리목적으로 복제/배포/전송할 경우 사전에 KISTI의 허락을
받아야 합니다.
③ NDSL에서 제공하는 콘텐츠를 보도, 비평, 교육, 연구 등을 위하여 정당한 범위 안에서 공정한 관행에
합치되게 인용할 수 있습니다.
④ NDSL에서 제공하는 콘텐츠를 무단 복제, 전송, 배포 기타 저작권법에 위반되는 방법으로 이용할 경우
저작권법 제136조에 따라 5년 이하의 징역 또는 5천만 원 이하의 벌금에 처해질 수 있습니다.
제 14 조 (유료서비스)
① 당 사이트 및 협력기관이 정한 유료서비스(원문복사 등)는 별도로 정해진 바에 따르며, 변경사항은 시행 전에
당 사이트 홈페이지를 통하여 회원에게 공지합니다.
② 유료서비스를 이용하려는 회원은 정해진 요금체계에 따라 요금을 납부해야 합니다.
제 5 장 계약 해지 및 이용 제한
제 15 조 (계약 해지)
회원이 이용계약을 해지하고자 하는 때에는 [가입해지] 메뉴를 이용해 직접 해지해야 합니다.
제 16 조 (서비스 이용제한)
① 당 사이트는 회원이 서비스 이용내용에 있어서 본 약관 제 11조 내용을 위반하거나, 다음 각 호에 해당하는
경우 서비스 이용을 제한할 수 있습니다.
- 2년 이상 서비스를 이용한 적이 없는 경우
- 기타 정상적인 서비스 운영에 방해가 될 경우
② 상기 이용제한 규정에 따라 서비스를 이용하는 회원에게 서비스 이용에 대하여 별도 공지 없이 서비스 이용의
일시정지, 이용계약 해지 할 수 있습니다.
제 17 조 (전자우편주소 수집 금지)
회원은 전자우편주소 추출기 등을 이용하여 전자우편주소를 수집 또는 제3자에게 제공할 수 없습니다.
제 6 장 손해배상 및 기타사항
제 18 조 (손해배상)
당 사이트는 무료로 제공되는 서비스와 관련하여 회원에게 어떠한 손해가 발생하더라도 당 사이트가 고의 또는 과실로 인한 손해발생을 제외하고는 이에 대하여 책임을 부담하지 아니합니다.
제 19 조 (관할 법원)
서비스 이용으로 발생한 분쟁에 대해 소송이 제기되는 경우 민사 소송법상의 관할 법원에 제기합니다.
[부 칙]
1. (시행일) 이 약관은 2016년 9월 5일부터 적용되며, 종전 약관은 본 약관으로 대체되며, 개정된 약관의 적용일 이전 가입자도 개정된 약관의 적용을 받습니다.