• Journal of Microbiology and Biotechnology
• /
• v.30 no.12
• /
• pp.1876-1884
• /
• 2020

Ethanol often accumulates during the process of wine fermentation, and mitophagy has critical role in ethanol output. However, the relationship between mitophagy and ethanol stress is still unclear. In this study, the expression of ATG11 and ATG32 genes exposed to ethanol stress was accessed by real-time quantitative reverse transcription polymerase chain reaction (qRT-PCR). The result indicated that ethanol stress induced expression of the ATG11 and ATG32 genes. The colony sizes and the alcohol yield of atg11 and atg32 were also smaller and lower than those of wild type strain under ethanol whereas the mortality of mutants is higher. Furthermore, compared with wild type, the membrane integrity and the mitochondrial membrane potential of atg11 and atg32 exhibited greater damage following ethanol stress. In addition, a greater proportion of mutant cells were arrested at the G1/G0 cell cycle. There was more aggregation of peroxide hydrogen (H2O2) and superoxide anion (O2•-) in mutants. These changes in H2O2 and O2•- in yeasts were altered by reductants or inhibitors of scavenging enzyme by means of regulating the expression of ATG11 and ATG32 genes. Inhibitors of the mitochondrial electron transport chain (mtETC) also increased production of H2O2 and O2•- by enhancing expression of the ATG11 and ATG32 genes. Further results showed that activator or inhibitor of autophagy also activated or inhibited mitophagy by altering production of H2O2 and O2•. Therefore, ethanol stress induces mitophagy which improves yeast the tolerance to ethanol and the level of mitophagy during ethanol stress is regulated by ROS derived from mtETC.

• Molecules and Cells
• /
• v.41 no.1
• /
• pp.35-44
• /
• 2018

Mitochondria are responsible for supplying of most of the cell's energy via oxidative phosphorylation. However, mitochondria also can be deleterious for a cell because they are the primary source of reactive oxygen species, which are generated as a byproduct of respiration. Accumulation of mitochondrial and cellular oxidative damage leads to diverse pathologies. Thus, it is important to maintain a population of healthy and functional mitochondria for normal cellular metabolism. Eukaryotes have developed defense mechanisms to cope with aberrant mitochondria. Mitochondria autophagy (known as mitophagy) is thought to be one such process that selectively sequesters dysfunctional or excess mitochondria within double-membrane autophagosomes and carries them into lysosomes/vacuoles for degradation. The power of genetics and conservation of fundamental cellular processes among eukaryotes make yeast an excellent model for understanding the general mechanisms, regulation, and function of mitophagy. In budding yeast, a mitochondrial surface protein, Atg32, serves as a mitochondrial receptor for selective autophagy that interacts with Atg11, an adaptor protein for selective types of autophagy, and Atg8, a ubiquitin-like protein localized to the isolation membrane. Atg32 is regulated transcriptionally and post-translationally to control mitophagy. Moreover, because Atg32 is a mitophagy-specific protein, analysis of its deficient mutant enables investigation of the physiological roles of mitophagy. Here, we review recent progress in the understanding of the molecular mechanisms and functional importance of mitophagy in yeast at multiple levels.

• Journal of Life Science
• /
• v.7 no.3
• /
• pp.167-171
• /
• 1997

As an initial effort to elucidate RNA: protein binding in a way to regulate translation initiation and phosphorylation, a cDNA encoding a double-stranded RNA binding factor (RBFII)was isolated from Hela ZAPII cDNA library by affinity screening using [$\alpha$$^{-32}$P] UMP-labeled HIV Rev-responsive element(RRE) RNA. The nucleotide sequence of RBF (or TRBP) cDNA except the 5’end. At the 5’end, This common ORF was fused in-frame to N-terminal residues of Lac-Z through a unique 138 nt sequence encoding 46residues in the case of RBFII and a 63 nt sequence encoding 21 residuces in the case of RBFI. The context of ATG appearing first in the sequences suggests that both these cDNA inserts are incomplete at the 5’end.

• Korean Journal of Microbiology
• /
• v.24 no.3
• /
• pp.204-210
• /
• 1986

One clone(pANt32) carring tRNA/sup Arg/ gene was selected from Aspergillus total tRNA gene clones. The nucleotide sequences of this tRNA gene were determined by Maxam and Gilbert's chemical cleavage methods. The sequence of this tRNA gene is as follow; 5'GGCCGGCTGCCCAATTGGCAAGGCGTCTGACTACGAATCAGGAGAT TGCAGGTTCGAGCCCTGCGTGGGTCA3'. This sequence conicides with the characteristecs of other eukaryotic tRNA. Some consensus sequences (ACT-TA bow, TATTTT and T-cluster) are found in both 5'-end and 3'-end flanking regions.

• Asian-Australasian Journal of Animal Sciences
• /
• v.32 no.4
• /
• pp.592-598
• /
• 2019

Objective: Autophagy is a bulk degradation system for intracellular proteins which contributes to skeletal muscle homeostasis, according to previous studies in humans and rodents. However, there is a lack of information on the physiological role of autophagy in the skeletal muscle of meat animals. This study was planned as a pilot study to investigate changes in expression of two major autophagy-related genes, microtubule-associated protein 1 light chain $3{\beta}$ (MAP1LC3B) and autophagy related 7 (ATG7) in fattening beef cattle, and to compare them with skeletal muscle growth. Methods: Six castrated Japanese Black cattle (initial body weight: $503{\pm}20kg$) were enrolled in this study and fattened for 7 months. Three skeletal muscles, M. longissimus, M. gluteus medius, and M. semimembranosus, were collected by needle biopsy three times during the observation period, and mRNA levels of MAP1LC3B and ATG7 were determined by quantitative reverse-transcription polymerase chain reaction. The expression levels of genes associated with the ubiquitin-proteasome system, another proteolytic mechanism, were also analyzed for comparison with autophagy-related genes. In addition, ultrasonic scanning was repeatedly performed to measure M. longissimus area as an index of muscle growth. Results: Our results showed that both MAP1LC3B and ATG7 expression increased over the observation period in all three skeletal muscles. Interestingly, the increase in expression of these two genes in M. longissimus was highly correlated with ultrasonic M. longissimus area and body weight. On the other hand, the expression of genes associated with the ubiquitin-proteasome system was unchanged during the same period. Conclusion: These findings suggest that autophagy plays an important role in the growth of skeletal muscle of fattening beef cattle and imply that autophagic activity affects meat productivity.

• BMB Reports
• /
• v.32 no.5
• /
• pp.436-439
• /
• 1999

Shigella sonnei is an important cause of human enteric infections. S. sonnei KNIH104S was previously reported to be isolated from Korean shigellosis patients. We cloned a 2.8-kb KpnI fragment containing the recA gene encoding a recombinase from the chromosomal DNA of S. sonnei KNIH104S. This recombinant plasmid was named pRAK28. E. coli HB101, a recA mutant, cannot grow on Luria-Bertani medium in the presence of the alkylating agent methylmethane sulfonate, however, E. coli HB101 harboring pRAK28 was found to grow on this medium. As far as we know, we are the first to sequence the recA gene from S. sonnei. This gene is composed of 1062 base pairs with an ATG initiation codon and a TAA termination codon. Nucleotide sequence comparison of the S. sonnei recA gene exhibited 99.7% and 99.5% identity with those of S. flexneri and E. coli, respectively.

• Journal of fish pathology
• /
• v.8 no.1
• /
• pp.37-46
• /
• 1995

The amino acid analysis of polyhedrin protein and nucleotide sequence of polyhedrin gene in H. cunea nuclear polyhedrosis virus (HcNPV) genome have been studied. Polyhedrin had three polypeptide bands in SDS - polyactylamide gel electrophoresis. The major polypeptide had a molecular weight of 25 kd. The polyhedrin was composed of 17 different amino acids. HcNPV DNA was digested with EcoRI restriction enzyme and hybridized with ($\alpha^{32}P$) -labelled AcNPV polyhedrin gene cDNA. The polyhedrin gene was located on the fragment of EcoRI-H. The EcoRI - H fragment containing polyhedrin gene was cloned into the EcoRI site of pUC8 vector which was confirmed with southern blotting, and the recombinant plasmid containg polyhedrin gene was designated as hPE-H. The promoter region of polyhedrin genomic DNA was sequenced. The sequences identified as the TATA box was found at the 5' flanking region of the polyhedrin genomic DNA approximately -79 bp upstream from the transcriptional start site. But CAAT-like box was not shown near the TATA-like box in the polyhedrin gene. Four tandem repeats with the sequence 5' -CTAATAT-3' and 5'-TAAATAA-3' were found between -141 and -108 or -83 upstream and -52 bp downstream from the translation start site. About -141 bp region upstream from the translational start site was highly AT (78%) rich. The coding region for the polyhedrin starts and ends with ATG and TAA, respectively.

• Journal of Life Science
• /
• v.21 no.3
• /
• pp.400-405
• /
• 2011

Autophagy, a highly conserved mechanism of internal quality control, is essential for the maintenance of cellular homeostasis and for the orchestration of an efficient cellular response to stress. During aging, the efficiency of autophagic degradation declines and intracellular waste products accumulate. Therefore, the aim of this study is to investigate the effects of exercise on autophagic response in skeletal muscle. Twenty-four Young (4 month) and Old (12 month) ICR-type white male mice were divided into a control group (CON: n=6) and exercise training group (Tr: n=6) after an adaptation period of 1 week. Exercise consisted of treadmill running at 16.4 m/min with a 4% incline, 40 min/day and 5 days/week for 8 weeks. Cervical dislocation was performed at 48 hours after the last round of exercise, after which the gastrocnemius skeletal muscle were immediately collected. The results of verifying autophagy formation showed that the Sarcopenia index was decreased in the Old mice compared to the Young. However, it increased with exercise training in the Old. Lipidation LC3-II, Becline-1, and Atg7 were decreased in the Old mice compared to the Young. However, Lipidation LC3-II was significantly increased in the trained Old mice (Young:1 Vs Old:$1.32{\pm}0.042$, p<0.05). Based on these data, we suggest that autophagy regulatory events are the attenuated in Old mice, but that they are enhanced with exercise training.

• Tuberculosis and Respiratory Diseases
• /
• v.80 no.3
• /
• pp.270-276
• /
• 2017

Background: A disputed rpoB mutation is a specific type of rpoB mutation that can cause low-level resistances to rifampin (RIF). Here, we aimed to assess the frequency and types of disputed rpoB mutations in Mycobacterium tuberculosis isolates from South Korea. Methods: Between August 2009 and December 2015, 130 patients exhibited RIF resistance on the MTBDRplus assay at Asan Medical Center. Among these cases, we identified the strains with disputed rpoB mutation by rpoB sequencing analysis, as well as among the M. tuberculosis strains from the International Tuberculosis Research Center (ITRC). Results: Among our cases, disputed rpoB mutations led to RIF resistance in at least 6.9% (9/130) of the strains that also exhibited RIF resistance on the MTBDRplus assay. Moreover, at the ITRC, sequencing of the rpoB gene of 170 strains with the rpoB mutation indicated that 23 strains (13.5%) had the disputed mutations. By combining the findings from the 32 strains from our center and the ITRC, we identified the type of disputed rpoB mutation as follows: CTG511CCG (L511P, n=8), GAC516TAC (D516Y, n=8), CTG533CCG (L533P, n=8), CAC526CTC (H526L, n=4), CAC526AAC (H526N, n=3), and ATG515GTG (M515V, n=1). Conclusion: Disputed rpoB mutations do not seem to be rare among the strains exhibiting RIF resistance in South Korea.

• Korean Journal of Microbiology
• /
• v.32 no.3
• /
• pp.215-221
• /
• 1994

The complete nucleotide sequence of the cloned pga gene encoding the penicillin G acylase of Bacillus megaterium ATCC 14945 and its 5'- and 3'-flanking regions was determined. The sequence revealed only one large open reading frame (2,406 hp) of the penicillin G acylase (pga) gene. Upstream from ATG of the pga gene, there was a putative ribosome binding site, Shine-Dalgarno sequence. The promoter-like structure, - 10 and - 35 sequences, was also found. Following the stop codon, TAG, a structure reminiscent of the E. coli rho-independent transcription terminator was present. The amino acid sequence was deduced from the nucleotide sequence. The molecular mass of the polypeptide was 91,983 Da. There was a potential signal sequence in its amino-terminal region. A comparison of its deduced amino acid sequence with other characterized penicillin G acylases and the result of SDS-polyacrylamide gel electrophoresis of the purified enzyme showed that a precursor polypeptide of 92 kDa was processed into two dissimilar ${\alpha}$ and ${\beta}$-subunits of 25 and 61 kDa.