• Journal of Plant Biology
• /
• 제35권2호
• /
• pp.155-163
• /
• 1992

식물세포에 tumor를 유발하는 Agrobacterium tumefaciens pTiA6 plasmid에서 virE 유전자의 발현조절기작을 분자적수준에서 규명하기 위하여 virE promoter의 5＇-말단을 제거하여 얻은 truncated virE 재조합플라스미드를 이용하여 virE promoter의 조절부위에 대하여 연구하였다. virE promoter의 기능이 존재하는 truncated virE 재조합플라스미드인 pJS201은 전기영동에 의하여 virE promoter의 5＇-말단으로부터 약 130개의 염기가 제거된 것으로 측정되었다. 한편 virE promoter의 기능을 상실한 pJS301에서 dideoxy chain termination방법으로 truncated virE promoter 염기서열을 결정한 결과 263개의 염기가 제거된 것으로 확인되었다. 따라서 virE promoter의 조절부위는 virE promoter의 5＇-말단으로부터 약 130번째의 염기에서 263번째의 염기사이에 존재하는 것으로 사료되며, 이 사이에 23개의 염기로 이루어진 역반복서열(AACTTTGCGCTATAGGCAAAGTT)이 존재하고 있는데, 이 부위가 virE operon의 발현에 있어서 RNA polymerase의 최초 인식부위(recognition site)일 것으로 사료된다.

• 미생물학회지
• /
• 제24권1호
• /
• pp.1-6
• /
• 1986

Tumor-inducing (Ti) plasmid which may be used in genetic engineering of higher plants, was isolated from Agrobacterium tumefaciens in Korea. Among the 7 strains of A. tumefaciens isolated from various regions in Korea, KU12, KU13, KU14, and KU49 strains were confirmed to contain plasmid. The isolated Ti plasmids were digested with 4 kinds of restriction enzymes, respectively. According to the result of the cleavage patterns, we confirmed that these plasmids in the KU12, KU13, KU14 and KU49 strains are different.

• KSBB Journal
• /
• 제27권6호
• /
• pp.341-346
• /
• 2012

Indican (indoxyl-${\beta}$-D-glucoside) is a colorless natural compound and can be used as a precursor for the production of indigo. This production step only require an enzyme, ${\beta}$-glucosidase, that readily screened from microbial resource by using selective media supplemented with indican as a sole carbon source. Agrobacterium tumefaciens was well grown in this media and thus presumed to produce a related enzyme. The corresponding gene, encoding a protein with a calculated molecular mass of 51 kDa, was cloned and overexpressed as MBP fusion proteins. The purified enzyme was determined to be a dimer and showed the maximum activity for indican at pH 7.0 and $40^{\circ}C$. The kinetic parameters for indican, Km and Vmax, were determined to be 1.4 mM and 373.8 ${\mu}M/min/mg$, respectively. The conversion yield of indican into indigo using this enzyme was about 1.7-1.8 folds higher than that of previously isolated enzyme from Sinorhizobium meliloti. Additionally, this enzyme was able to hydrolyze various ${\beta}$-1,4 glycoside substrates.

• Current Research on Agriculture and Life Sciences
• /
• 제10권
• /
• pp.137-145
• /
• 1992

본 연구에 사용한 시료는 형성층 유래의 캘러스를 0.01mg/${\ell}$ 2, 4-D, 0.5mg/${\ell}$ BAP, 3% sucrose, 0.75% 한천을 첨가한 MS배지에서 재분화 시킨 개체를 이용하였다. 시료의 대량증식은 1.0mg/${\ell}$ BAP를 첨가한 MS 배지에서 실시하였으며 엽전개는 식물생장조절제가 첨가되지 않은 MS배지로 옮겨서 실행하였다. Agrobacteria를 이용한 형질 전환은 엽절편, 절간조직등을 박테리아를 묻힌 침으로 자극하여 식물체 분화를 유도하였다. 그 결과 엽절편 조직에서는 분화된 식물체를 얻지 못했으나, 절간조직의 측아에서는 49%에 달하는 24개체가 분화되었다. 이들 분화된 줄기는 kanamycin이 100mg/${\ell}$이 함유된 선발 배지에서 일차적인 선발을 하여 최종적으로 GUS 유전자 검정을 한 결과 처음에 접종한 50개체중 형질전환 된 것으로 추정되는 5개체를 얻어서 형질 전환 추정 비율은 10%에 달한 것으로 나타났다.

• KSBB Journal
• /
• 제7권3호
• /
• pp.191-200
• /
• 1992

토양 시료로부터A. tumefaciens를 분리 동정하고 이를 옥수수의 형질전환에 이용하기 위하여 binary vector를 이용하여 형질전환시킨 후 옥수수의 중배축 조직과 공존배양을 실시하였다. Schroth의 선택배지에서 선별된 colony들은 단일 형태를 나타내었다. 분리 균주는 해바라기 유식물의 잎조직에 종양을 형성하였으며, 거대 plasmid를 가지고 있었는데 이는 대조균주인 C58이나 Ach5의 plasmid와는 다른 종류였다. 분리균주들에 의해 형성된 tumor의 형태 및 균주의 생리, 생화학적 특성들에 의하여 공시균주를 A. tumefaciens biovar 1으로 동정하였으며 nopaline 형으로 추정하였다. 분리 균주중 AK204를 사용하여 옥수수 조직을 형질전환시키기 위하여 선택maker를 가지고 있는 binary vector(pGA642)를 균주내로 전이 시켰다. 이로 인하여 형질전환된 AK204를 옥수수 중배축 조직과 공존배양하므로서 옥수수 조직세포를 형질전환 시킨 결과, 1차적으로 Km에 저항성을 띠는 형질전환체를 선발할 수 있었으며, 그들의 가용성 단백질의 PAGE pattern이 변화되었음을 확인하였다.

• Applied Biological Chemistry
• /
• 제28권2호
• /
• pp.92-97
• /
• 1985

Agrobacterium tumefaciens A 136에 자외선은 조사(照射)하여 Ti-plasmid 숙주로 이용할 수 있는 arginine 영양요구주를 선발하고자 하였다. A. tumefaciens의 생육을 600nm에서의 흡광도(吸光度)로 측정할 때 TY배지에서 2% 접종시 7시간 부터 16시간 사이에 대수기를 보였고 generation time은 4.8시간이었다. $800{\mu}w/cm^2$의 자외선 강도로 $30{\sim}50$초 조사(照射)에서 $1{\sim}0.1%$의 생존율을 보였다. 자외선 조사(照射)로 mutation을 유도한 다음 5,000개의 colony에서 15개의 mutants를 얻었으며 그 중 2개는 arginine 영양요구주였고 3개는 asparagine 영양요구주였다.

• Journal of Microbiology and Biotechnology
• /
• 제16권4호
• /
• pp.647-650
• /
• 2006

D-Psicose 3-epimerase (DPE) catalyzes the interconversion of D-fructose to D-psicose by epimerizing the carbon-3 position. The DPE from Agrobacterium tumefaciens was cloned and expressed in Escherichia coli. The expressed enzyme was purified by affinity chromatography on an IMAC, gel filtration chromatography on a Sephacryl S-300 HR, and anion-exchange chromatography on a RESOURCE Q. The molecular mass of the purified enzyme was estimated to be about 135 kDa by Superdex 200 gel filtration chromatography, corresponding to a homotetramer. The enzyme produced crystals suitable for X-ray diffraction to a $2.0{\AA}$ resolution at 100 K. The crystals were found to belong to the orthorhombic space group $P2_12_12_1$, with unit-cell parameters a=102.4, b=113.0, and $c=131.8{\AA}$. In addition, the calculated packing parameter $(V_m)$ was $2.79{\AA}^3/Da$, the solvent content was 55.92%, and an asymmetric unit consisted of four monomers.

• 식물조직배양학회지
• /
• 제27권2호
• /
• pp.95-100
• /
• 2000

배추에서 분리된 cytosolic glutathione reductase (BcGR1)유전자를 벼에 효과적으로 도입하기 위하여 몇 가지 실험을 수행하여 얻어진 결과를 요약하면 다음과 같다. 수정 후 3주된 미숙배에서 유도된 캘러스를 이용하여 형질전환 효율의 품종간 차이를 조사한 바 '대립벼'가 42.5%로 가장 높게 나타났다. 공동배양 배지 내에 acetosyringone (AS)이 첨가되지 않았을 경우 형질전환된 개체를 얻을 수 없었으나, 50$\mu$M을 첨가되었을 때 41.0%의 가장 높은 형질 전환효율을 나타내었다. PCR 증폭과 Southern blot 분석을 실시한바 BcGR1 유전자가 형질전환체의 게놈상에 정상적으로 삽입된 것이 확인되었으며, T$_1$세대 28개통 중 17개체의 hygromycin 저항성 유전형질이 3:1로 분리되었다.

• 한국초지조사료학회지
• /
• 제22권2호
• /
• pp.101-106
• /
• 2002

환경 스트레스에 의해 야기되는 활성 산소종에 의한 피해에 내성을 가지는 식물의 개발을 위하여 딸기 유래의 cytosolic ascorbate peroxidase 유전자(ApxSC7)를 Agrobacterium tume-faciens LBA4404를 매개로 형질전환 시켰다. Hygromycin으로 선발된 캘러스로부터 재분화 된 식물체는 야생형과 비교하여 형태적으로 차이를 나타내지 않았다. PCR 및 Southern blot 분석을 통하여 형질전환 식물체의 염색체 내에 ApxSC7 유전자가 integration 되었음을 확인하였다. 담배 잎으로부터 total RNA를 분리하여 Northern blot 분석을 실시한 결과, 도입된 유전자가 형질전환 식물체 내에서 지속적으로 발현된다는 것을 확인하였다.

• Journal of Plant Biotechnology
• /
• 제48권3호
• /
• pp.156-164
• /
• 2021

Spirodela polyrhiza, from the Lemnaceae family, are small aquatic plants that offer an alternative plant-based system for the expression of recombinant proteins. However, no turion transformation protocol has been established in this species. In this study, we exploited a pB7YWG2 vector harboring the eYFP gene that encodes enhanced yellow fluorescent protein (eYFP), which has been extensively used as a reporter and marker to visualize recombinant protein localization in plants. We adopted Agrobacterium tumefaciens-mediated turion transformation via vacuum infiltration to deliver the eYFP gene to turions, special vegetative forms produced by duckweeds to endure harsh conditions. Transgenic turions regenerated several duckweed fronds that exhibited yellow fluorescent emissions under a fluorescence microscope. Western blotting verified the expression of the eYFP protein. To the best of our knowledge, this is the first report of an efficient protocol for generating transgenic S. polyrhiza expressing eYFP via Agrobacterium tumefaciens-mediated turion transformation. The ability of turions to withstand harsh conditions increases the portability and versatility of transgenic duckweeds, favoring their use in the further development of therapeutic compounds in plants.