• Journal of Microbiology and Biotechnology
• /
• v.9 no.2
• /
• pp.184-190
• /
• 1999

The use of the polymerase chain reaction (PCR) method was described using two sets of primers based on the ceuN gene (JEJ 1 and JEJ 2) which encodes a protein involved in siderophore transport and 16S rRNA gene (pA and pB) for the sensitive and specific detection of enteropathogen Campylobacter jejuni. Six oligonucleotides were utilized in an amplification experiment and PCR products of predicted sizes were generated from whole cells and boiled cell lysates at the same intensity. Two sets of the primer pairs, JEJ and pAB, were specific enough for all C. jejuni strains tested for the direct use of whole cells without DNA extraction or lysis steps. In the PCR using the pAB primer pair, the detection limit, as determined by the ethidium bromide staining of the amplification products on agarose gels, was at the level of $10^1$ bacteria cells or less in both the pure culture and artificially inoculated milk and chicken enrichment samples, whereas the detection limit with the JEJ primer pair was relatively low, i.e. $10^3$ cells or more in the same PCR samples. The PCR method using either a primer JEJ or pAB was both repeatable and specific for the detection of C. jejuni in food. This method is simply completed within 4 h.

• Journal of Microbiology and Biotechnology
• /
• v.16 no.5
• /
• pp.724-730
• /
• 2006

A sequence characterized amplified region (SCAR) marker, which was tightly linked with the A1 mating type locus in Phytophthora infestans, was developed. During the random amplified polymorphic DNA-based phylogenic studies of 33 isolates of P infestans collected from year 2002 to 2004, we found an A1 mating type-specific DNA fragment. This 573-bp DNA fragment was generated only in the genomic DNA of the A1 mating types, when OPC-5 primer was used. Based on the specific DNA sequence, we designed the primer sets for generating the A1 mating type-specific 569-bp DNA fragment. When 33 genomic DNAs of P. infestans were subjected to PCR amplification using different primer combinations, the A1 mating type-specific DNA was amplified, when LB-1F and LB-2R primers were used. The specific 569-bp DNA fragment was generated only from all 18 A1 strains, but not from 15 A2 mating type strains. These results corresponded to the mating type discriminating bioassay of 33 isolates of P. infestans. Therefore, the primer combination of LB-1F/LB2R was chosen as a SCAR marker. Overall, this study indicates that the SCAR marker could be developed into a useful tool for mating type determination of P. infestans.

• Journal of Microbiology and Biotechnology
• /
• v.27 no.5
• /
• pp.909-915
• /
• 2017

Bifidobacterium bifidum BGN4 (BGN4) has many proven beneficial effects, including antiallergy and anticancer properties. It has been commercialized and used in several probiotic products, and thus strain-specific identification of this strain is very valuable for further strain-dependent physiological study. For this purpose, we developed novel multiplex polymerase chain reaction (PCR) primer sets for strain-specific detection of BGN4 in commercial products and fecal samples of animal models. The primer set was tested on seven strains of B. bifidum and 75 strains of the other Bifidobacterium species. The BGN4-specific regions were derived using megaBLAST against genome sequences of various B. bifidum databases and four sets of primers were designed. As a result, only BGN4 produced four PCR products simultaneously whereas the other strains did not. The PCR detection limit using BGN4-specific primer sets was $2.8{\times}10^1CFU/ml$ of BGN4. Those primer sets also detected and identified BGN4 in the probiotic products containing BNG4 and fecal samples from a BGN4-fed animal model with high specificity. Our results indicate that the PCR assay from this study is an efficient tool for the simple, rapid, and reliable identification of BGN4, for which probiotic strains are known.

• International Journal of Oral Biology
• /
• v.46 no.4
• /
• pp.155-159
• /
• 2021

This study aimed to develop strain-specific polymerase chain reaction (PCR) primers to detect Fusobacterium hwasookii KCOM 1249^T, F. hwasookii KCOM 1253, F. hwasookii KCOM 1256, F. hwasookii KCOM 1258, and F. hwasookii KCOM 1268 on the basis of nucleotide sequences of a gene specific to each strain. The unique genes for each F. hwasookii strain were determined on the basis of their genome sequences using Roary. The strain-specific PCR primers based on each strain-specific gene were designed using PrimerSelect. The specificity of each PCR primer was determined using the genomic DNA of the 5 F. hwasookii strains and 25 strains of oral bacterial species. The detection limit and sensitivity of each strain-specific PCR primer pair were determined using the genomic DNA of each target strain. The results showed that the strain-specific PCR primers correspond to F. hwasookii KCOM 1249^T, F. hwasookii KCOM 1253, F. hwasookii KCOM 1258, F. hwasookii KCOM 1256/F. nucleatum subsp. polymorphum KCOM 1260, or F. hwasookii KCOM 1268/Fusobacterium sp. oral taxon 203 were developed. The detection limits of these strain-specific PCR primers ranged from 0.2 to 2 ng of genomic DNA for each target strain. The results suggest that these strain-specific PCR primers are valuable in quality control for detecting specific F. hwasookii strains.

• Journal of Microbiology
• /
• v.39 no.1
• /
• pp.56-61
• /
• 2001

Plasmodiophora brassicae is an obligate parasite, a causal organism of clubroot disease in crucifers that can survive in the soil as resting spores for many years. P. brassicae causes great losses in susceptible varieties of crucifers throughout the world. In this present study, an in planta molecular marker for the detection of P. bassicae was developed using an oligonucleotide primer set foam the small subunit gene (18S like) and internal transcribed spacer (ITS) region of rDNA. The specific primer sequences determined were TCAGCTTGAATGCTAATGTG (ITS5) and CTACCTCATTTGAGATCCTTTGA (PB-2). This primer set was used to specifically detect p. bassicae in planta. The amplicon using the specific primer set was about 1,000 bp. However, the test plant and other soil-borne fungi including Fusarium spp. and Rhizoctonia app., as well as bacteria such as Pseudomonas app. and Erwinia sup. did not show any reaction with the primer set.

• Research in Plant Disease
• /
• v.18 no.2
• /
• pp.73-79
• /
• 2012

Phytophthora katsurae is a fungal pathogen responsible for chestnut ink disease. We designed two duplex primer sets (SOPC 1F/1R+KatI 3F/5R, SOPC 1-1F/1-1R+KatI 3F/5R) to detect P. katsurae. SOPC 1F/1R and SOPC 1-1F/1-1R primer pairs were designed for sequence characteristic amplification regions (SCAR) marker, and KatI 3F/5R primer pair was used for P. katsurae-specific primer designed from internal transcribed spacer (ITS) region. To assess the sensitivity of duplex PCR, genomic DNA was serially diluted 10-fold to make the final concentrations from 1 mg/ml to 1 ng/ml. The sensitivity for two primer sets were 1 ${\mu}g/ml$ and 100 ng/ml, respectively. To find detection limits for zoospores of P. katsurae, each zoospore suspension was serially diluted 10-fold to make the final concentrations from $1{\times}10^6$ to $1{\times}10^2$ cells/ml, and then DNA was extracted. The limits of detection for all of two primer sets were $1{\times}10^5$ cells/ml. All of two primer sets were specific to P. katsurae in PCR detection and did not produce any P. katsurae-specific PCR amplicons from other 16 Phytophthora species used as the control. This study shows that duplex PCR using two primer sets might be a useful tool for rapid and efficient detection of P. katsurae.

• Korean Journal of Microbiology
• /
• v.39 no.1
• /
• pp.36-39
• /
• 2003

The rapid and reliable 16S rDNA multiplex polymerase chain reaction (PCR) assay was established to characterize bacterial etiologies of middle ear effusion. These etiologies included Haemophilus influenzae, Moraxella catarrhalis and Streptococcus pneumonia, which were detected in middle-ear effusion (MEE) samples taken from patient with otitis media. A total of 39 MEE samples were aspirated from 26 patients. DNA was extracted from MEE samples, and PCR was done with DNA extracts by using the common primers, which is localized at C4 region in the 16S rDNA gene of all bacterial species, and species-specific primers: (i) Haemophilus-specific primer, (ii) Moraxella- specific primer, and (iii) Streptococcus-specific primer. Among 39 samples tested, 24 (61.5%) were positive for H. influenzae, 10 (25.6%) were positive for M. catarrhalis, 3(7.7%) were positive for S. pneumonia, and 11 (28%) were negative for 165 rDNA multiplex PCR reaction. Nine samples (28.6%) exhibited a mixed infection and were positive for both H. infuenzae and M. catarrhalis. We suggested that 16S rDNA multiplex PCR is a useful method to identify rapidly for rapid identification of the pathogenic bacteria and characterization of bacterial etiologies of middle ear effusion.

• The Plant Pathology Journal
• /
• v.29 no.1
• /
• pp.99-104
• /
• 2013

To detect five plant viruses (Beet black scorch virus, Beet necrotic yellow vein virus, Eggplant mottled dwarf virus, Pelargonium zonate spot virus, and Rice yellow mottle virus) for quarantine purposes, we designed 15 RT-PCR primer sets. Primer design was based on the nucleotide sequence of the coat protein gene, which is highly conserved within species. All but one primer set successfully amplified the targets, and gradient PCRs indicated that the optimal temperature for the 14 useful primer sets was $51.9^{\circ}C$. Some primer sets worked well regardless of annealing temperature while others required a very specific annealing temperature. A primer specificity test using plant total RNAs and cDNAs of other plant virus-infected samples demonstrated that the designed primer sets were highly specific and generated reproducible results. The newly developed RT-PCR primer sets would be useful for quarantine inspections aimed at preventing the entry of exotic plant viruses into Korea.

• The Plant Pathology Journal
• /
• v.21 no.1
• /
• pp.55-58
• /
• 2005

In order to diagnose and differentiate jujube witches' broom (JWB) phytoplasma rapidly, oligonucleotide primer pair, 16Sr(V) F/R, for polymerase chain reactions (PCRs) was designed on the basis of 16S rRNA sequences of JWB phytoplasma. The PCR employing phytoplasma universal primer pair P1/P7 consistently amplified DNA in all tested phytoplasma isolates. But no phytoplasma DNA was detected from healthy jujube seedlings. The nested PCR, the primer pair 16S(V) F/R, about 460 bp fragment, amplified DNA in all tested JWB and related phytoplasmas including ligustrum witches' broom phytoplasma of the 16S rRNA group V, but no DNA amplification was detected from other phytoplasma strains such as groups 16SrI (Aster yellows) and 16SrXII (Stolbur group) in which mulberry dwarf phytoplasma and chrysanthemum witches' broom phytoplasma belong to, respectively. The same results were obtained from both Korean and Chinese isolates of JWB phytoplasma. Nested-PCR using phytoplasma universal primer pair P1/P7 and 16SrV group-specific primer pair 16S(V) F/R could detect group V phytoplasmas rapidly and easily, in particular JWB phytoplasma.

• Mycobiology
• /
• v.31 no.1
• /
• pp.23-31
• /
• 2003

With universal primer ITS1-F, the specific DHJ2 primer was developed to detect the Ectomycorrhizal(ECM) root tips in soil and to identify the species of ECM fungi, as based on DNA sequences of rDNA stored in GeneBank of NCBI. This primer was designed with the common sites of rDNA of Amanita and Boletus, and was also designed with several DNA programs provided by NCBI. The DNA fragments synthesized by PCR were calculated to be 1,000 to 1,200 bps of DNA located to 18s to 28s rDNA to contain two variable sites of ITS, indicating much diversities for specific species or ecotypes of ECM fungi. The primer DHJ2 reacted with the genomic DNA's extracted from the tissues of basidiocarp at the rate of 73 of 80 fungi collected produced single bands with a 1,100 bps length. The DNA fragment synthesized with the genomic DNA that extracted from eight ECM tips of Pinus densiflora was confirmed and analysized to the rDNAs of ECM in full sequences, and informed to be a ECM fungal species in the forest.