• The Plant Pathology Journal
• /
• v.39 no.5
• /
• pp.494-503
• /
• 2023

Xanthomonas campestris pv. campestris (Xcc) is a plant pathogen of Brassica crops that causes black rot disease throughout the world. At present, 11 physiological races of Xcc (races 1-11) have been reported. The conventional method of using differential cultivars for Xcc race detection is not accurate and it is laborious and time-consuming. Therefore, the development of specific molecular markers has been used as a substitute tool because it offers an accurate and reliable result, particularly a quick diagnosis of Xcc races. Previously, our laboratory has successfully developed race-specific molecular markers for Xcc races 1-6. In this study, specific molecular markers to identify Xcc race 7 have been developed. In the course of study, whole genome sequences of several Xcc races, X. campestris pv. incanae, X. campestris pv. raphani, and X. campestris pv. vesicatoria were aligned to identify variable regions like sequence-characterized amplified regions and insertions and deletions specific to race 7. Primer pairs were designed targeting these regions and validated against 22 samples. The polymerase chain reaction analysis revealed that three primer pairs specifically amplified the DNA fragment corresponding to race 7. The obtained finding clearly demonstrates the efficiency of the newly developed markers in accurately detecting Xcc race 7 among the other races. These results indicated that the newly developed marker can successfully and rapidly detect Xcc race 7 from other races. This study represents the first report on the successful development of specific molecular markers for Xcc race 7.

• Journal of Plant Biology
• /
• v.34 no.1
• /
• pp.37-43
• /
• 1991

Mesophyll protoplasts of Nicoliana labacum ($NR^{-}/SR^{+}$) and N glulinosa were electrofused with AC field of 0.5 MHz and 1 kV DC pulse for 2 ms. Fused protoplasts were selected and cultured to the green cell clusters in $MSNO_3$ medium containing 1.2 mg!ml streptomycin sulfate. Four plant lines regenerated from selected colonies showed both parental morphological characteristics of leaf and flower and these plant lines were confirmed as somatic hybrids based on electrophoretic patterns of leaf peroxidase. In XhoI restriction patterns of chloroplast DNA, these hybrid plant lines expressed both parent common restriction sites and parent specific sites. One of these hybrid lines exhibited interspecific pattern of both parental chloroplast genomes. indicating nine both parent common sites, one N labacum specific site and two N glutinosa specific sites. sites.

• The Plant Pathology Journal
• /
• v.23 no.3
• /
• pp.215-218
• /
• 2007

The occurrence and relative incidence of viruses including Cucumber mosaic virus (CMV), Zucchini yellow mosaic virus (ZYMV), Papaya rings pot virus (PRSV), and Watermelon mosaic virus (WMV), Cucumber green mottle mosaic virus (CGMMV), Kyuri green mottle mosaic virus (KGMMV), and Melon necrotic spot virus (MNSV) were surveyed from main melon (Cucumis melo L.) production areas in Jeonnam province during 2000-2002. Virus disease incidences of melon cultivating fields were 0% and 11% in spring and fall 2000; 40%, 2.1%, and 8.8% in spring, summer, and fall 2001; and 6.3 % in spring 2002 in main cultivated areas in Jeonnam province, respectively. Field disease incidences of melon virus infections were 0% and 18.8% in spring and fall 2000; 50%, 38.5%, and 82.6% in spring, summer, and fall 2001; and 47.4% in spring 2002, respectively. Total of 101 melon samples showing typical disease symptoms were collected from 2000 to 2002 and tested for virus infection by RT-PCR. Potyvirus-specific DNA fragments for WMV, ZYMV, and PRSV were amplified from 46, 5, and 4 samples, respectively. MNSV specific DNA fragment was amplified from 18 samples. CMV-specific DNA fragment was detected from only 3 samples.

• Proceedings of the Korean Society for Agricultural Machinery Conference
• /
• 2000.11c
• /
• pp.764-769
• /
• 2000

A new transplant production system that produces high quality plug seedlings of specific crop has been studied. It is a plant factory designed to produce massive amount of virus free seedlings. The design concept for building this plant factory is to realize maximum energy efficiency and minimum initial investment and running cost. The basic production strategy is the sitespecific management. In this case, the management of the growth of individual plantlet is considered. This requires highly automated and information intensive production system in a closed aseptic environment the sterilized specific crops. One of the key components of this sophisticated system is the irrigation system. The conditions that this irrigation system has to satisfy are: 1. to perform the site specific crop management in irrigation and 2. to meet the no waste standard. The objective of this study is to develop an irrigation scheduling that can implement the no waste standard.

• The Plant Pathology Journal
• /
• v.17 no.4
• /
• pp.194-200
• /
• 2001

Chrysanthemum stunt viroid (CSVd) ws identified in chrysanthemum cv. Chunkwang showing symptoms of stunt with leaf distortion (K1) and stunt with chlorosis of leaves (K2) collected from the main cultivation area of Masan, Kyongnam province in Korea. The specific RNAs related with the diseased chrysanthemums were detected. Full-length 354 bp CSVd cDNAs were amplified from infected tissue by reverse transcription and polymerase chain reaction using a pair of primers specific for CSVd sequence. The amplified cDNA products were analyzed by agarose gel electrophoresis and the specific cDNAs were cloned. Nucleotide sequences of the two CSVd isolates K1 and K2 varied. Phylogenetic analysis of the nucleotide sequences of CSVd isolates indicated that K1 was closely related with J2 and Am 2 isolates. K1 and K2 were transmitted by grafting to Dendranthema grandiflorum cv. Mistletoe, Gynura aurantiaca, and Lycopersicon esculentum cv. Rutgers. This is the first report of CSVd in D. grandiflorum in Korea.

• Journal of Plant Biology
• /
• v.39 no.3
• /
• pp.189-195
• /
• 1996

The major cuticular components have been shown to be synthesized in the epidermis. Therefore, cloning of epidermis-specific genes could yield information to be used to isolate and characterize the enzymes involved in the cuticle biosynthesis. A subtractive cDNA library was prepared from Senecio odorus in which epidermis-specific cDNAs were enriched. Differential screening of the library using epidermal and non-epidermal probes revealed two cDNAs. One of them designated epi425 was identified, based on the sequence homology, as a member of a new class in the LTP gene family and the other clone designated epi23 as a gene encoding an aldehyde decarbonylase. Northern blot analyses showed that epi425 and epi23 cDNAs hybridized with a transcript of about 600 and 2, 100 nucleotides, respectively, from the epidermis but not from the non-epidermal tissues. Further characterization of these clones will provide more information on the mechanism of the cuticle biosynthesis.

• BMB Reports
• /
• v.38 no.6
• /
• pp.646-649
• /
• 2005

Human neuronal growth inhibitory factor (GIF), a metalloprotein classified as metallothionein-3, is specifically expressed in mammal central nervous system (CNS). In these Studies the specific antibody to human GIF was prepared and used to search the epitope of human GIF by enzyme-linked immunosorbent assay (ELISA) and sequence comparison. The result of ELISA showed the epitope of human GIF may locate on a octapeptide (EAAEAEAE) in the $\alpha$-domain of human GIF, and the result of nerve cell culture indicated that the biological activity of GIF may be affected by the specific antibody.

• Journal of Microbiology
• /
• v.39 no.1
• /
• pp.56-61
• /
• 2001

Plasmodiophora brassicae is an obligate parasite, a causal organism of clubroot disease in crucifers that can survive in the soil as resting spores for many years. P. brassicae causes great losses in susceptible varieties of crucifers throughout the world. In this present study, an in planta molecular marker for the detection of P. bassicae was developed using an oligonucleotide primer set foam the small subunit gene (18S like) and internal transcribed spacer (ITS) region of rDNA. The specific primer sequences determined were TCAGCTTGAATGCTAATGTG (ITS5) and CTACCTCATTTGAGATCCTTTGA (PB-2). This primer set was used to specifically detect p. bassicae in planta. The amplicon using the specific primer set was about 1,000 bp. However, the test plant and other soil-borne fungi including Fusarium spp. and Rhizoctonia app., as well as bacteria such as Pseudomonas app. and Erwinia sup. did not show any reaction with the primer set.

• Journal of Microbiology and Biotechnology
• /
• v.20 no.9
• /
• pp.1295-1299
• /
• 2010

Recently, recombinant Streptomyces venezuelae has been established as a heterologous host for microbial production of flavanones and stilbenes, a class of plant-specific polyketides. In the present work, we expanded the applicability of the S. venezuelae system to the production of more diverse plant polyketides including flavones and flavonols. A plasmid with the synthetic codon-optimized flavone synthase I gene from Petroselium crispum was introduced to S. venezuelae DHS2001 bearing a deletion of the native pikromycin polyketide synthase gene, and the resulting strain generated flavones from exogenously fed flavanones. In addition, a recombinant S. venezuelae mutant expressing a codon-optimized flavanone $3{\beta}$-hydroxylase gene from Citrus siensis and a flavonol synthase gene from Citrus unshius also successfully produced flavonols.

• The Plant Pathology Journal
• /
• v.26 no.3
• /
• pp.267-270
• /
• 2010

We designed a sensitive and specific PCR-based method with enterobacterial repetitive intergenic consensus (ERIC) primer to detect Erwinia pyrifoliae, which cause shoot blight in Asian pear, from a mixed culture and infected plant materials. The primers specifically detected only E. pyrifoliae and showed no cross-reactivity with other bacterial phytopathogens.