• Journal of Microbiology
• /
• 제39권1호
• /
• pp.56-61
• /
• 2001

Plasmodiophora brassicae is an obligate parasite, a causal organism of clubroot disease in crucifers that can survive in the soil as resting spores for many years. P. brassicae causes great losses in susceptible varieties of crucifers throughout the world. In this present study, an in planta molecular marker for the detection of P. bassicae was developed using an oligonucleotide primer set foam the small subunit gene (18S like) and internal transcribed spacer (ITS) region of rDNA. The specific primer sequences determined were TCAGCTTGAATGCTAATGTG (ITS5) and CTACCTCATTTGAGATCCTTTGA (PB-2). This primer set was used to specifically detect p. bassicae in planta. The amplicon using the specific primer set was about 1,000 bp. However, the test plant and other soil-borne fungi including Fusarium spp. and Rhizoctonia app., as well as bacteria such as Pseudomonas app. and Erwinia sup. did not show any reaction with the primer set.

• Carbon letters
• /
• 제13권2호
• /
• pp.94-98
• /
• 2012

Herein, macroporous carbon foams were successfully prepared with phenol and formaldehyde as carbon precursors and an ionic liquid, 1-butyl-3-methylimidazolium hexafluorophosphate ($BMIPF_6$), as a pore generator by employing a polymerization-induced phase separation method. During the polycondensation reaction of phenol and formaldehyde, $BMIPF_6$ forms a clustered structure which in turn yields macropores upon carbonization. The morphology, pore structure, electrical conductivity of carbon foams were investigated in terms of the amount of the ionic liquid. The as-prepared macroporous carbon foams had around 100-150 ${\mu}m$-sized pores. More importantly, the electrical conductivity of the carbon foams was linearly improved by the addition of $BMIPF_6$. To the best of the author's knowledge, this is the first result reporting the possibility of the use of an ionic liquid to prepare porous carbon materials.

• 한국콘크리트학회:학술대회논문집
• /
• 한국콘크리트학회 2005년도 봄학술 발표회 논문집(II)
• /
• pp.457-460
• /
• 2005

The stone powder sludges, which are occurred in aggregate production company, have classified the specified waste, so taking place the environment pollution and the disposal cost. In this causes, the stone powder sludge is required the development of recycling technique. This study concerned with the using possibility of stone powder sludge on light weight concrete. We acquired the fundamental date on recycling technique of stone sludges, by hydro-thermal reaction. The results shows that it is possible to develop the light weight concrete, having various range of properties according to the content of foam.

• Journal of Electrochemical Science and Technology
• /
• 제9권3호
• /
• pp.229-237
• /
• 2018

The electrochemical sensing performance of metal-graphene hybrid based sensor may be significantly decreased due to the dissolution and aggregation of metal catalyst during operation. For the first time, we developed a novel large-area high quality three dimensional graphene foam-incorporated gold nanoparticles (3D-GF@Au) via chemical vapor deposition method and employed as free-standing electrocatalysis for non-enzymatic electrochemical glucose detection. 3D-GF@Au based sensor is capable to detect glucose with a wide linear detection range of $2.5{\mu}M$ to 11.6 mM, remarkable low detection limit of $1{\mu}M$, high selectivity, and good stability. This was resulted from enhanced electrochemical active sites and charge transfer possibility due to the stable and uniform distribution of Au NPs along with the enhanced interactions between Au and GF. The obtained results indicated that 3D-GF@Au hybrid can be expected as a high quality candidate for non-enzymatic glucose sensor application.

• 공업화학
• /
• 제19권4호
• /
• pp.427-431
• /
• 2008

해수 하에서 경시변화에 따른 경질 폴리우레탄 폼의 물성변화를 알아보기 위해 이소시아네이트 인덱스를 변화시키며 경질 폴리우레탄 폼(PUF)을 합성하였다. 해수 하에서 이소시아네이트의 인덱스가 90, 100, 130, 150으로 증가함에 따라 PUF의 인장강도는 각각 10%, 3%, 7%, 4%씩 감소하였고, 압축강도는 각각 7%, 6%, 5%, 4%씩 감소하였다. PUF의 물성저하를 규명하기 위해 PUF의 기공을 확인한 결과 기공의 변화는 없었다. 해수 하에서 PUF의 유리전이온도($T_g$), 인장 모듈러스는 증가하였는데 적외선 스펙트럼 분석결과 우레아, 알로파네이트, 바이우렛이 증가하는 것을 알 수 있었다. 해수 하에서 PUF는 가교도 증가하고 이로 인해 폼이 brittle하게 형성되어 $T_g$의 증가에도 불구하고 기계적 물성이 저하된 것으로 사료된다. 해수 하에서 PUF의 물성변화를 고찰하기 위해 만능시험기, 시차 주사 열량계, 주사 전자 현미경, 적외선 분광계를 이용하였다.

• Korean Chemical Engineering Research
• /
• 제46권6호
• /
• pp.1039-1042
• /
• 2008

폐폴리우레탄의해중합에의하여제조된재생폴리올의작용기를증가시키기위하여해중합시첨가한 pentaerythritol(PEN, 작용기(f)=4) 또는 sorbitol(SOR, f=6)이 생성된 재생 폴리올의 작용기와 이를 사용하여 제조한 경질 폴리우레탄폼(polyurethane rigid foam; PUR)의 기계적 물성에 미치는 영향을 조사하였다. PEN 또는 SOR를 첨가한 경우 OH 작용기가 2.2에서 약 2.8로 증가하였고, PUR의 치수안전성 등을 비롯한 기계적 물성이 크게 향상됨을 확인하였다. 이러한 결과는 폴리올의 작용기가 증가하여 제조한 PUR의 가교밀도를 향상시킨 것으로 해석되었다. 또한 재생 폴리올의 폴리올 시스템에 대한 사용량을 8 wt%에서 약 20 wt%로 증가시킬수 있었다.

• 한국세라믹학회지
• /
• 제41권7호
• /
• pp.555-559
• /
• 2004

폴리실록산 고분자의 자가 발포과정을 이용하여 세라믹 다공질체를 제조하였다. 고분자가 가교반응을 하는 과정에서 발생하는 물과 알콜 증기를 이용하면 고분자 용융액 내에 기공을 형성할 수 있다. 세라믹 다공질체 내의 기공의 크기와 모양은 고분자 용융액의 점도에 따라 크게 달라진다. 충진제인 A1$_2$O$_3$ 함량이 증가하면 기공 크기는 감소하며 이는 A1$_2$O$_3$의 입자크기가 감소하여도 비슷한 양상을 보였다. 고분자 용융액의 점도는 고분자의 가교반응정도에 따라서도 영향을 받는다. 발포 전에 13$0^{\circ}C$에서 열처리를 하면 점도는 증가하며 다공질체의 기공 안정성은 증가한다. 제조된 세라믹 다공질체의 밀도와 압축강도는 발포과정에서의 승온속도에 따라 다른 값을 보였다.

• 한국화재소방학회논문지
• /
• 제27권4호
• /
• pp.41-46
• /
• 2013

본 연구는 가구류를 구성하는 주요 재료의 열적조건에 따른 반응특성과 화염전파해석에 필요한 열해리 물성을 제공하기 위해 열중량분석을 수행하였다. 실험대상 시편은 가구류에 널리 적용되는 MDF 판재와 코팅재, 합성피혁과 쿠션재 등이며 가열율 $10^{\circ}C/min$, 최대 온도 $600^{\circ}C$까지 실험을 수행하였다. 실험결과 MDF 소재의 경우 $324^{\circ}C$에서 피크 반응을 나타냈었으며 MDF 코팅재의 경우 초기 피크반응온도가 $270{\sim}280^{\circ}C$로 감소하였다. 합성피혁과 폼 소재의 경우 재료를 구성하는 폴리머의 종류에 따라 기준온도와 기준 반응율이 차이를 보였으나 기준온도는 $270^{\circ}C$와 $420^{\circ}C$ 정도로 비교적 유사한 경향을 나타냈다. Lyon 등이 제시한 방법에 의해 반응상수와 활성화 에너지를 산정하기 위해 시편의 기준 온도와 기준 반응율을 제시하였으며 이러한 기초 물성연구를 통해 화염전파특성을 이해함과 동시에 화재해석의 신뢰성을 향상시키는데 기여하고자 한다.

• Journal of the Korean Wood Science and Technology
• /
• 제26권4호
• /
• pp.43-49
• /
• 1998

The availability of large quantities of waste woods provides an impetus for investigating woody biomass potential uses. Polyurethane (PU) foams are prepared with reacting isocyanates and polyols, and are used. in various industry fields. Thus, lignocellulosic waste raw-materials are proposed as replacement for synthetic polyol to PU foam formulation. In this study PU foams were manufactured from liquefied woods, methanediisocyanate(MDI), catalyst, foaming stabilizer, and viscosity aids. The polyol content, isocyanate.hydroxyl group (NCO/OH) ratio, and water content were varied to evaluate their effects on the foaming and water absorption of the PU foams. Less than 400 Molecular weight. of polyethylene glycol(PEG) and 1 to 3 solvent to woody raw-material ratio were desirable for liquefying woody materials. Liquefying rate was increased with more than 3 % addition of inorganic and organic catalysts and raising reaction temperature more than $150^{\circ}C$. Addition of starch enhanced liquefying of woody materials. Fourty percents of starch resulted in about 90% liquefying rates. Foaming rates were increased with increasing moisture contents of liquefied wood. Moisture contents of 0.6% resulted in 5 time-foaming rates, and seven percents of moisture contents more than 30 time-foaming rates. But, an increase in water content may result in a decrease in cross-links between wood polyol and isocyanate, because the NCO/OH ratio is constant. Increasing moisture contents have significantly decreased density of PU foams. The optimum water content should be about 2.5% or less in this adopted condition.

• 한국가스학회지
• /
• 제8권2호
• /
• pp.1-7
• /
• 2004

경질폴리우레탄 폼 제조 시 water, HFC-365mfc, HFC-245fa, HCFC-l4lb, CFC-11, n-pentane을 사용하여 단일발포제가 폼의 물성에 미치는 영향을 알아보고, HFC-365mtc 를 주 발포제로 사용하고 water, HFC-245fa, HCFC-l4lb, CFC-11, n-Pentane을 보조발포제로 사용하여 혼합 발포제(co-blowing agent)가 폼의 물성에 미치는 영향을 고찰하였다. 단일 발포제의 영향에서 압축강도는 물의 경우가 3.83kg/m^2으로 가장 큰 값을 나타내었으며 Scanning electron/microscopy(SEM)분석 결과 HFC-245fa와 HFC-365mfc의 경우가 기공분포 크기가 가장 작은 것으로 관찰이 되었다. 열전도도는 CFC-11, HFC-245fa와 HFC-365mfc의 경우가 낮은 열전도도 값을 보여서 폼의 열전도도는 기공크기와 발포제의 열전도도에 의존함을 알 수 있었다. 혼합 발포제의 영향에서는 HFC-245fa를 $30mo1e\%$로 사용한 경우가 가장 높은 기계적 물성 값을 나타내었으며 이는 SEM 분석 결과, HFC-245fa를 보조 발포제로 사용한 경우가 가장 작은 기공분포크기를 나타내었기 때문이었다. 혼합 발포제의 영향에서도 폼의 열전도도는 기공크기와 발포제의 열전도도에 의존함을 확인 할 수 있었다.