• Journal of Microbiology
• /
• v.39 no.1
• /
• pp.56-61
• /
• 2001

Plasmodiophora brassicae is an obligate parasite, a causal organism of clubroot disease in crucifers that can survive in the soil as resting spores for many years. P. brassicae causes great losses in susceptible varieties of crucifers throughout the world. In this present study, an in planta molecular marker for the detection of P. bassicae was developed using an oligonucleotide primer set foam the small subunit gene (18S like) and internal transcribed spacer (ITS) region of rDNA. The specific primer sequences determined were TCAGCTTGAATGCTAATGTG (ITS5) and CTACCTCATTTGAGATCCTTTGA (PB-2). This primer set was used to specifically detect p. bassicae in planta. The amplicon using the specific primer set was about 1,000 bp. However, the test plant and other soil-borne fungi including Fusarium spp. and Rhizoctonia app., as well as bacteria such as Pseudomonas app. and Erwinia sup. did not show any reaction with the primer set.

• Carbon letters
• /
• v.13 no.2
• /
• pp.94-98
• /
• 2012

Herein, macroporous carbon foams were successfully prepared with phenol and formaldehyde as carbon precursors and an ionic liquid, 1-butyl-3-methylimidazolium hexafluorophosphate ($BMIPF_6$), as a pore generator by employing a polymerization-induced phase separation method. During the polycondensation reaction of phenol and formaldehyde, $BMIPF_6$ forms a clustered structure which in turn yields macropores upon carbonization. The morphology, pore structure, electrical conductivity of carbon foams were investigated in terms of the amount of the ionic liquid. The as-prepared macroporous carbon foams had around 100-150 ${\mu}m$-sized pores. More importantly, the electrical conductivity of the carbon foams was linearly improved by the addition of $BMIPF_6$. To the best of the author's knowledge, this is the first result reporting the possibility of the use of an ionic liquid to prepare porous carbon materials.

• Proceedings of the Korea Concrete Institute Conference
• /
• 2005.05b
• /
• pp.457-460
• /
• 2005

The stone powder sludges, which are occurred in aggregate production company, have classified the specified waste, so taking place the environment pollution and the disposal cost. In this causes, the stone powder sludge is required the development of recycling technique. This study concerned with the using possibility of stone powder sludge on light weight concrete. We acquired the fundamental date on recycling technique of stone sludges, by hydro-thermal reaction. The results shows that it is possible to develop the light weight concrete, having various range of properties according to the content of foam.

• Journal of Electrochemical Science and Technology
• /
• v.9 no.3
• /
• pp.229-237
• /
• 2018

The electrochemical sensing performance of metal-graphene hybrid based sensor may be significantly decreased due to the dissolution and aggregation of metal catalyst during operation. For the first time, we developed a novel large-area high quality three dimensional graphene foam-incorporated gold nanoparticles (3D-GF@Au) via chemical vapor deposition method and employed as free-standing electrocatalysis for non-enzymatic electrochemical glucose detection. 3D-GF@Au based sensor is capable to detect glucose with a wide linear detection range of $2.5{\mu}M$ to 11.6 mM, remarkable low detection limit of $1{\mu}M$, high selectivity, and good stability. This was resulted from enhanced electrochemical active sites and charge transfer possibility due to the stable and uniform distribution of Au NPs along with the enhanced interactions between Au and GF. The obtained results indicated that 3D-GF@Au hybrid can be expected as a high quality candidate for non-enzymatic glucose sensor application.

• Applied Chemistry for Engineering
• /
• v.19 no.4
• /
• pp.427-431
• /
• 2008

The rigid polyurethane foams (PUF) were prepared using polyols with 90, 110, 130, and 150 isocyanate index. The effect of sea water on the physical properties of PUF with the increase in isocyanate (NCO) index and ageing time was investigated. Tensile strengths and compressive strengths of the PUFs decreased up to 10% and 7% with an increase in ageing time, respectively. Cell morphology of the PUF under sea water was turned out to be the same as that in the ambient condition. It was observed that $T_g$ and tensile modulus of the PUF under sea water increased. The results showed an additional cross-link reaction of non-reacted MDI and the change of NCO peak as observed from FT-IR spectrum.

• Korean Chemical Engineering Research
• /
• v.46 no.6
• /
• pp.1039-1042
• /
• 2008

In order to increase a functionality, OH value, for a recycled polyol prepared from the glycolysis reaction of a waste polyurethane rigid foam(PUR), the effect of an addition of pentaerythritol(PEN, functionality(f)=4) or sorbitol(SOR, f=6) to the its glycolysis reactor on the prepared polyol functionality and the mechanical properties of the polyurethane prepared using it was investigated. The OH values increased from 2.2 for a virgin to 2.8 for the recycled polyol. There was an increase in the mechanical properties including dimensional stability for PUR prepared using the recycled polyol, in which the increased OHs provided higher crosslinking density during PUR synthesis. In addition, the amount of the recycled polyol in the polyol system increased to from 8 to 20 wt% to give better mechanical properties to the PUR.

• Journal of the Korean Ceramic Society
• /
• v.41 no.7
• /
• pp.555-559
• /
• 2004

Ceramic foams were prepared by a self-blowing process of a polysiloxane with A1$_2$O$_3$ as a filler. The release of water and ethanol vapor during the condensation reaction of the polymer triggered the pores in the polymer melt. The size. interconnectivity and shape of the pores in the ceramic foams were strongly dependent on the viscosity of the polymer melt, which could be varied by the content and size oi the filler. When the content of the filler inceased and the size of the filler decreased. the size of the pores were decreased and the thickness between the pores were increased. In the addition, the viscosity of polymer melt increased by the pretreatment at 130$^{\circ}C$ for Ire intermolecular cross linking thereby stabilizing the foam structure. The density and compressive strength of the ceramic foams were affected by the heating rate during the blowing process.

• Fire Science and Engineering
• /
• v.27 no.4
• /
• pp.41-46
• /
• 2013

The present study has been conducted to investigate the reaction kinetics and pyrolysis parameters for flame propagation analysis of furniture material components. TGA measurement for component materials such as MDF (medium density fiberboad) panel including coating material, synthetic leather and foam cushion are performed under maximum temperature of $600^{\circ}C$ and heating rate of $10^{\circ}C/min$. The results of TGA have shown that the peak temperature of MDF panel was $324^{\circ}C$ and the initial peak temperature of coating material decreased by $270{\sim}280^{\circ}C$. In the case of synthetic leather and foam materials, the reference temperature and reference rate depend on the type of polymer consisting the sample, the initial kinetic characteristics was classified into 2 categories of about $270^{\circ}C$ and $420^{\circ}C$ of reference temperature for the tested synthetic materials. The present study showed the pyrolysis parameters of reference temperature and reference rate proposed by Lyon to evaluate the pre-exponential factor and activation energy. The present study can contribute to improve the reliability of computational fire analysis and enhance the understanding of fire propagation phenomena based on the thermal properties study of material.

• Journal of the Korean Wood Science and Technology
• /
• v.26 no.4
• /
• pp.43-49
• /
• 1998

The availability of large quantities of waste woods provides an impetus for investigating woody biomass potential uses. Polyurethane (PU) foams are prepared with reacting isocyanates and polyols, and are used. in various industry fields. Thus, lignocellulosic waste raw-materials are proposed as replacement for synthetic polyol to PU foam formulation. In this study PU foams were manufactured from liquefied woods, methanediisocyanate(MDI), catalyst, foaming stabilizer, and viscosity aids. The polyol content, isocyanate.hydroxyl group (NCO/OH) ratio, and water content were varied to evaluate their effects on the foaming and water absorption of the PU foams. Less than 400 Molecular weight. of polyethylene glycol(PEG) and 1 to 3 solvent to woody raw-material ratio were desirable for liquefying woody materials. Liquefying rate was increased with more than 3 % addition of inorganic and organic catalysts and raising reaction temperature more than $150^{\circ}C$. Addition of starch enhanced liquefying of woody materials. Fourty percents of starch resulted in about 90% liquefying rates. Foaming rates were increased with increasing moisture contents of liquefied wood. Moisture contents of 0.6% resulted in 5 time-foaming rates, and seven percents of moisture contents more than 30 time-foaming rates. But, an increase in water content may result in a decrease in cross-links between wood polyol and isocyanate, because the NCO/OH ratio is constant. Increasing moisture contents have significantly decreased density of PU foams. The optimum water content should be about 2.5% or less in this adopted condition.

• Journal of the Korean Institute of Gas
• /
• v.8 no.2 s.23
• /
• pp.1-7
• /
• 2004

The physical properties of rigid polyurethane foam(PUF) synthesized using various types of blowing agents such as water, HFC-365mfc, HFC-245fa, HCFC-l4lb, CFC-11 and n-pentane were studied. The blending effect of blowing agents were also studied. The thermal conductivity, reaction rate, and cell morphology of the PUF with various blending ratio of blowing agents were investigated. The PUF blown by water shows the highest compressive strength among other single blowing agents. The thermal conductivity of PUFs blown by HFC-245fa and HFC-365mfc are close to that of PUFs blown by CFC-11. When HFC-365mfc was mixed with HFC-245fa(30mo1e$\%$) as coblowing agent, the mechanical property shows the highest value among other coblowing agents. It is that the thermal conductivity of PUFs depends on cell size of PUFs as well as thermal conductivity of blowing agent in gaseous form.