Plasmodiophora brassicae is an obligate parasite, a causal organism of clubroot disease in crucifers that can survive in the soil as resting spores for many years. P. brassicae causes great losses in susceptible varieties of crucifers throughout the world. In this present study, an in planta molecular marker for the detection of P. bassicae was developed using an oligonucleotide primer set foam the small subunit gene (18S like) and internal transcribed spacer (ITS) region of rDNA. The specific primer sequences determined were TCAGCTTGAATGCTAATGTG (ITS5) and CTACCTCATTTGAGATCCTTTGA (PB-2). This primer set was used to specifically detect p. bassicae in planta. The amplicon using the specific primer set was about 1,000 bp. However, the test plant and other soil-borne fungi including Fusarium spp. and Rhizoctonia app., as well as bacteria such as Pseudomonas app. and Erwinia sup. did not show any reaction with the primer set.
Herein, macroporous carbon foams were successfully prepared with phenol and formaldehyde as carbon precursors and an ionic liquid, 1-butyl-3-methylimidazolium hexafluorophosphate ($BMIPF_6$), as a pore generator by employing a polymerization-induced phase separation method. During the polycondensation reaction of phenol and formaldehyde, $BMIPF_6$ forms a clustered structure which in turn yields macropores upon carbonization. The morphology, pore structure, electrical conductivity of carbon foams were investigated in terms of the amount of the ionic liquid. The as-prepared macroporous carbon foams had around 100-150 ${\mu}m$-sized pores. More importantly, the electrical conductivity of the carbon foams was linearly improved by the addition of $BMIPF_6$. To the best of the author's knowledge, this is the first result reporting the possibility of the use of an ionic liquid to prepare porous carbon materials.
Jung Ji Yong;Kim Ha Seok;Choi Sun Mi;Choi Se Jin;Lee Seong Yeon;Kim Jin Man
Proceedings of the Korea Concrete Institute Conference
/
2005.05b
/
pp.457-460
/
2005
The stone powder sludges, which are occurred in aggregate production company, have classified the specified waste, so taking place the environment pollution and the disposal cost. In this causes, the stone powder sludge is required the development of recycling technique. This study concerned with the using possibility of stone powder sludge on light weight concrete. We acquired the fundamental date on recycling technique of stone sludges, by hydro-thermal reaction. The results shows that it is possible to develop the light weight concrete, having various range of properties according to the content of foam.
Bui, Quoc Bao;Nguyen, Dang Mao;Nguyen, Thi Mai Loan;Lee, Ku Kwac;Kim, Hong Gun;Ko, Sang Cheol;Jeong, Hun
Journal of Electrochemical Science and Technology
/
v.9
no.3
/
pp.229-237
/
2018
The electrochemical sensing performance of metal-graphene hybrid based sensor may be significantly decreased due to the dissolution and aggregation of metal catalyst during operation. For the first time, we developed a novel large-area high quality three dimensional graphene foam-incorporated gold nanoparticles (3D-GF@Au) via chemical vapor deposition method and employed as free-standing electrocatalysis for non-enzymatic electrochemical glucose detection. 3D-GF@Au based sensor is capable to detect glucose with a wide linear detection range of $2.5{\mu}M$ to 11.6 mM, remarkable low detection limit of $1{\mu}M$, high selectivity, and good stability. This was resulted from enhanced electrochemical active sites and charge transfer possibility due to the stable and uniform distribution of Au NPs along with the enhanced interactions between Au and GF. The obtained results indicated that 3D-GF@Au hybrid can be expected as a high quality candidate for non-enzymatic glucose sensor application.
The rigid polyurethane foams (PUF) were prepared using polyols with 90, 110, 130, and 150 isocyanate index. The effect of sea water on the physical properties of PUF with the increase in isocyanate (NCO) index and ageing time was investigated. Tensile strengths and compressive strengths of the PUFs decreased up to 10% and 7% with an increase in ageing time, respectively. Cell morphology of the PUF under sea water was turned out to be the same as that in the ambient condition. It was observed that $T_g$ and tensile modulus of the PUF under sea water increased. The results showed an additional cross-link reaction of non-reacted MDI and the change of NCO peak as observed from FT-IR spectrum.
Myoung, Kyo Lim;Kim, Min Gyu;Ko, Jang Myoun;Chun, Jong Han
Korean Chemical Engineering Research
/
v.46
no.6
/
pp.1039-1042
/
2008
In order to increase a functionality, OH value, for a recycled polyol prepared from the glycolysis reaction of a waste polyurethane rigid foam(PUR), the effect of an addition of pentaerythritol(PEN, functionality(f)=4) or sorbitol(SOR, f=6) to the its glycolysis reactor on the prepared polyol functionality and the mechanical properties of the polyurethane prepared using it was investigated. The OH values increased from 2.2 for a virgin to 2.8 for the recycled polyol. There was an increase in the mechanical properties including dimensional stability for PUR prepared using the recycled polyol, in which the increased OHs provided higher crosslinking density during PUR synthesis. In addition, the amount of the recycled polyol in the polyol system increased to from 8 to 20 wt% to give better mechanical properties to the PUR.
Ceramic foams were prepared by a self-blowing process of a polysiloxane with A1$_2$O$_3$ as a filler. The release of water and ethanol vapor during the condensation reaction of the polymer triggered the pores in the polymer melt. The size. interconnectivity and shape of the pores in the ceramic foams were strongly dependent on the viscosity of the polymer melt, which could be varied by the content and size oi the filler. When the content of the filler inceased and the size of the filler decreased. the size of the pores were decreased and the thickness between the pores were increased. In the addition, the viscosity of polymer melt increased by the pretreatment at 130$^{\circ}C$ for Ire intermolecular cross linking thereby stabilizing the foam structure. The density and compressive strength of the ceramic foams were affected by the heating rate during the blowing process.
The present study has been conducted to investigate the reaction kinetics and pyrolysis parameters for flame propagation analysis of furniture material components. TGA measurement for component materials such as MDF (medium density fiberboad) panel including coating material, synthetic leather and foam cushion are performed under maximum temperature of $600^{\circ}C$ and heating rate of $10^{\circ}C/min$. The results of TGA have shown that the peak temperature of MDF panel was $324^{\circ}C$ and the initial peak temperature of coating material decreased by $270{\sim}280^{\circ}C$. In the case of synthetic leather and foam materials, the reference temperature and reference rate depend on the type of polymer consisting the sample, the initial kinetic characteristics was classified into 2 categories of about $270^{\circ}C$ and $420^{\circ}C$ of reference temperature for the tested synthetic materials. The present study showed the pyrolysis parameters of reference temperature and reference rate proposed by Lyon to evaluate the pre-exponential factor and activation energy. The present study can contribute to improve the reliability of computational fire analysis and enhance the understanding of fire propagation phenomena based on the thermal properties study of material.
The availability of large quantities of waste woods provides an impetus for investigating woody biomass potential uses. Polyurethane (PU) foams are prepared with reacting isocyanates and polyols, and are used. in various industry fields. Thus, lignocellulosic waste raw-materials are proposed as replacement for synthetic polyol to PU foam formulation. In this study PU foams were manufactured from liquefied woods, methanediisocyanate(MDI), catalyst, foaming stabilizer, and viscosity aids. The polyol content, isocyanate.hydroxyl group (NCO/OH) ratio, and water content were varied to evaluate their effects on the foaming and water absorption of the PU foams. Less than 400 Molecular weight. of polyethylene glycol(PEG) and 1 to 3 solvent to woody raw-material ratio were desirable for liquefying woody materials. Liquefying rate was increased with more than 3 % addition of inorganic and organic catalysts and raising reaction temperature more than $150^{\circ}C$. Addition of starch enhanced liquefying of woody materials. Fourty percents of starch resulted in about 90% liquefying rates. Foaming rates were increased with increasing moisture contents of liquefied wood. Moisture contents of 0.6% resulted in 5 time-foaming rates, and seven percents of moisture contents more than 30 time-foaming rates. But, an increase in water content may result in a decrease in cross-links between wood polyol and isocyanate, because the NCO/OH ratio is constant. Increasing moisture contents have significantly decreased density of PU foams. The optimum water content should be about 2.5% or less in this adopted condition.
The physical properties of rigid polyurethane foam(PUF) synthesized using various types of blowing agents such as water, HFC-365mfc, HFC-245fa, HCFC-l4lb, CFC-11 and n-pentane were studied. The blending effect of blowing agents were also studied. The thermal conductivity, reaction rate, and cell morphology of the PUF with various blending ratio of blowing agents were investigated. The PUF blown by water shows the highest compressive strength among other single blowing agents. The thermal conductivity of PUFs blown by HFC-245fa and HFC-365mfc are close to that of PUFs blown by CFC-11. When HFC-365mfc was mixed with HFC-245fa(30mo1e$\%$) as coblowing agent, the mechanical property shows the highest value among other coblowing agents. It is that the thermal conductivity of PUFs depends on cell size of PUFs as well as thermal conductivity of blowing agent in gaseous form.
본 웹사이트에 게시된 이메일 주소가 전자우편 수집 프로그램이나
그 밖의 기술적 장치를 이용하여 무단으로 수집되는 것을 거부하며,
이를 위반시 정보통신망법에 의해 형사 처벌됨을 유념하시기 바랍니다.
[게시일 2004년 10월 1일]
이용약관
제 1 장 총칙
제 1 조 (목적)
이 이용약관은 KoreaScience 홈페이지(이하 “당 사이트”)에서 제공하는 인터넷 서비스(이하 '서비스')의 가입조건 및 이용에 관한 제반 사항과 기타 필요한 사항을 구체적으로 규정함을 목적으로 합니다.
제 2 조 (용어의 정의)
① "이용자"라 함은 당 사이트에 접속하여 이 약관에 따라 당 사이트가 제공하는 서비스를 받는 회원 및 비회원을
말합니다.
② "회원"이라 함은 서비스를 이용하기 위하여 당 사이트에 개인정보를 제공하여 아이디(ID)와 비밀번호를 부여
받은 자를 말합니다.
③ "회원 아이디(ID)"라 함은 회원의 식별 및 서비스 이용을 위하여 자신이 선정한 문자 및 숫자의 조합을
말합니다.
④ "비밀번호(패스워드)"라 함은 회원이 자신의 비밀보호를 위하여 선정한 문자 및 숫자의 조합을 말합니다.
제 3 조 (이용약관의 효력 및 변경)
① 이 약관은 당 사이트에 게시하거나 기타의 방법으로 회원에게 공지함으로써 효력이 발생합니다.
② 당 사이트는 이 약관을 개정할 경우에 적용일자 및 개정사유를 명시하여 현행 약관과 함께 당 사이트의
초기화면에 그 적용일자 7일 이전부터 적용일자 전일까지 공지합니다. 다만, 회원에게 불리하게 약관내용을
변경하는 경우에는 최소한 30일 이상의 사전 유예기간을 두고 공지합니다. 이 경우 당 사이트는 개정 전
내용과 개정 후 내용을 명확하게 비교하여 이용자가 알기 쉽도록 표시합니다.
제 4 조(약관 외 준칙)
① 이 약관은 당 사이트가 제공하는 서비스에 관한 이용안내와 함께 적용됩니다.
② 이 약관에 명시되지 아니한 사항은 관계법령의 규정이 적용됩니다.
제 2 장 이용계약의 체결
제 5 조 (이용계약의 성립 등)
① 이용계약은 이용고객이 당 사이트가 정한 약관에 「동의합니다」를 선택하고, 당 사이트가 정한
온라인신청양식을 작성하여 서비스 이용을 신청한 후, 당 사이트가 이를 승낙함으로써 성립합니다.
② 제1항의 승낙은 당 사이트가 제공하는 과학기술정보검색, 맞춤정보, 서지정보 등 다른 서비스의 이용승낙을
포함합니다.
제 6 조 (회원가입)
서비스를 이용하고자 하는 고객은 당 사이트에서 정한 회원가입양식에 개인정보를 기재하여 가입을 하여야 합니다.
제 7 조 (개인정보의 보호 및 사용)
당 사이트는 관계법령이 정하는 바에 따라 회원 등록정보를 포함한 회원의 개인정보를 보호하기 위해 노력합니다. 회원 개인정보의 보호 및 사용에 대해서는 관련법령 및 당 사이트의 개인정보 보호정책이 적용됩니다.
제 8 조 (이용 신청의 승낙과 제한)
① 당 사이트는 제6조의 규정에 의한 이용신청고객에 대하여 서비스 이용을 승낙합니다.
② 당 사이트는 아래사항에 해당하는 경우에 대해서 승낙하지 아니 합니다.
- 이용계약 신청서의 내용을 허위로 기재한 경우
- 기타 규정한 제반사항을 위반하며 신청하는 경우
제 9 조 (회원 ID 부여 및 변경 등)
① 당 사이트는 이용고객에 대하여 약관에 정하는 바에 따라 자신이 선정한 회원 ID를 부여합니다.
② 회원 ID는 원칙적으로 변경이 불가하며 부득이한 사유로 인하여 변경 하고자 하는 경우에는 해당 ID를
해지하고 재가입해야 합니다.
③ 기타 회원 개인정보 관리 및 변경 등에 관한 사항은 서비스별 안내에 정하는 바에 의합니다.
제 3 장 계약 당사자의 의무
제 10 조 (KISTI의 의무)
① 당 사이트는 이용고객이 희망한 서비스 제공 개시일에 특별한 사정이 없는 한 서비스를 이용할 수 있도록
하여야 합니다.
② 당 사이트는 개인정보 보호를 위해 보안시스템을 구축하며 개인정보 보호정책을 공시하고 준수합니다.
③ 당 사이트는 회원으로부터 제기되는 의견이나 불만이 정당하다고 객관적으로 인정될 경우에는 적절한 절차를
거쳐 즉시 처리하여야 합니다. 다만, 즉시 처리가 곤란한 경우는 회원에게 그 사유와 처리일정을 통보하여야
합니다.
제 11 조 (회원의 의무)
① 이용자는 회원가입 신청 또는 회원정보 변경 시 실명으로 모든 사항을 사실에 근거하여 작성하여야 하며,
허위 또는 타인의 정보를 등록할 경우 일체의 권리를 주장할 수 없습니다.
② 당 사이트가 관계법령 및 개인정보 보호정책에 의거하여 그 책임을 지는 경우를 제외하고 회원에게 부여된
ID의 비밀번호 관리소홀, 부정사용에 의하여 발생하는 모든 결과에 대한 책임은 회원에게 있습니다.
③ 회원은 당 사이트 및 제 3자의 지적 재산권을 침해해서는 안 됩니다.
제 4 장 서비스의 이용
제 12 조 (서비스 이용 시간)
① 서비스 이용은 당 사이트의 업무상 또는 기술상 특별한 지장이 없는 한 연중무휴, 1일 24시간 운영을
원칙으로 합니다. 단, 당 사이트는 시스템 정기점검, 증설 및 교체를 위해 당 사이트가 정한 날이나 시간에
서비스를 일시 중단할 수 있으며, 예정되어 있는 작업으로 인한 서비스 일시중단은 당 사이트 홈페이지를
통해 사전에 공지합니다.
② 당 사이트는 서비스를 특정범위로 분할하여 각 범위별로 이용가능시간을 별도로 지정할 수 있습니다. 다만
이 경우 그 내용을 공지합니다.
제 13 조 (홈페이지 저작권)
① NDSL에서 제공하는 모든 저작물의 저작권은 원저작자에게 있으며, KISTI는 복제/배포/전송권을 확보하고
있습니다.
② NDSL에서 제공하는 콘텐츠를 상업적 및 기타 영리목적으로 복제/배포/전송할 경우 사전에 KISTI의 허락을
받아야 합니다.
③ NDSL에서 제공하는 콘텐츠를 보도, 비평, 교육, 연구 등을 위하여 정당한 범위 안에서 공정한 관행에
합치되게 인용할 수 있습니다.
④ NDSL에서 제공하는 콘텐츠를 무단 복제, 전송, 배포 기타 저작권법에 위반되는 방법으로 이용할 경우
저작권법 제136조에 따라 5년 이하의 징역 또는 5천만 원 이하의 벌금에 처해질 수 있습니다.
제 14 조 (유료서비스)
① 당 사이트 및 협력기관이 정한 유료서비스(원문복사 등)는 별도로 정해진 바에 따르며, 변경사항은 시행 전에
당 사이트 홈페이지를 통하여 회원에게 공지합니다.
② 유료서비스를 이용하려는 회원은 정해진 요금체계에 따라 요금을 납부해야 합니다.
제 5 장 계약 해지 및 이용 제한
제 15 조 (계약 해지)
회원이 이용계약을 해지하고자 하는 때에는 [가입해지] 메뉴를 이용해 직접 해지해야 합니다.
제 16 조 (서비스 이용제한)
① 당 사이트는 회원이 서비스 이용내용에 있어서 본 약관 제 11조 내용을 위반하거나, 다음 각 호에 해당하는
경우 서비스 이용을 제한할 수 있습니다.
- 2년 이상 서비스를 이용한 적이 없는 경우
- 기타 정상적인 서비스 운영에 방해가 될 경우
② 상기 이용제한 규정에 따라 서비스를 이용하는 회원에게 서비스 이용에 대하여 별도 공지 없이 서비스 이용의
일시정지, 이용계약 해지 할 수 있습니다.
제 17 조 (전자우편주소 수집 금지)
회원은 전자우편주소 추출기 등을 이용하여 전자우편주소를 수집 또는 제3자에게 제공할 수 없습니다.
제 6 장 손해배상 및 기타사항
제 18 조 (손해배상)
당 사이트는 무료로 제공되는 서비스와 관련하여 회원에게 어떠한 손해가 발생하더라도 당 사이트가 고의 또는 과실로 인한 손해발생을 제외하고는 이에 대하여 책임을 부담하지 아니합니다.
제 19 조 (관할 법원)
서비스 이용으로 발생한 분쟁에 대해 소송이 제기되는 경우 민사 소송법상의 관할 법원에 제기합니다.
[부 칙]
1. (시행일) 이 약관은 2016년 9월 5일부터 적용되며, 종전 약관은 본 약관으로 대체되며, 개정된 약관의 적용일 이전 가입자도 개정된 약관의 적용을 받습니다.