• 식물병연구
• /
• 제18권2호
• /
• pp.86-92
• /
• 2012

Plasmodiophora brassicae Woron.에 의한 뿌리혹병은 배추과 작물에 발생하는 전 세계적으로 가장 중요한 식물병 중 하나이다. 본 연구는 Brassica oleracea에 속하는 양배추와 브로콜리의 뿌리혹병에 대한 효율적인 저항성 검정 방법을 확립하기 위하여, 레이스 9인 GN1 균주를 이용하여 접종원의 농도와 P. brassicae 접종 후 배양 기간 등의 발병 조건에 따른 양배추와 브로콜리 뿌리혹병 발생을 조사하였다. 접종원의 농도는 14일 재배한 유묘에 포트 당 $2.5{\times}10^9$개의 포자를 접종하는 것이 적당하였으며, 안정적인 발병을 위하여 접종한 유묘는 3일 동안 $20^{\circ}C$ 생육상에서 하루에 12시간 광을 처리하며 배양하고, 그 후 온실($20{\pm}5^{\circ}C$)에서 5주 동안 재배한 후에 발병 정도를 조사하는 것이 요구되었다. 위의 검정법을 이용하여 레이스가 다른 P. brassicae 4개 포장 균주에 대한, 시판 중인 양배추 16종과 브로콜리 17종 품종의 저항성 정도를 실험한 결과, 레이스 9인 GN1, GN2 그리고 GS 균주에 대해서는 중도저항성을 보이는 몇 가지 품종이 있었다. 그러나 레이스 2인 YC 균주에 대해서는 실험한 모든 품종이 고도의 감수성 반응을 나타내었다. 따라서 이 방법은 양배추와 브로콜리 뿌리혹병 저항성을 검정하기 위한 효율적인 검정법이라는 것을 알 수 있었다.

• 식물병연구
• /
• 제18권2호
• /
• pp.123-128
• /
• 2012

We investigated the resistance of 50 commercial Chinese cabbage cultivars against clubroot disease caused by Plasmodiophora brassicae in the three difference fields, Suwon, Hwacheon, and Pyeongchang. Wilting symptom on Chinese cabbage was first observed at 15 days after transplanting in Pyeongchang and Hwacheon, while disease symptoms appeared later in Suwon after the rainy season. Among 50 cultivars, eight cultivars, SC26, SC29, SC30, SC31, SC34, SC46, SC47 and SC50 showed highly susceptible symptoms like wilting and heavy root galls in all three fields. Meanwhile, seven cultivars such as SC05, SC06, SC07, SC09, SC11, SC17, and SC36 showed moderate resistance with delayed wilting and few root galls. Only two cultivars, Chuwol (CB22) and Gohyangssam (CB23) were highly resistant to clubroot disease until the harvest season in all of the three fields. These two commercial cultivars may be considered as candidate cultivars for cultivation of organic Chinese cabbage in Suwon, Hwacheon, and Pyeongchang.

• 식물병과 농업
• /
• 제5권2호
• /
• pp.84-89
• /
• 1999

Development of root galls of clubroot disease on Chinese cabbage seedlings was first observed 17days after inoculation of Plasmodiophora brassicae at $25^{\circ}C$ 4-11days earlier than at 5, 20, 3$0^{\circ}C$ and 35$^{\circ}C$. Subsequent enlargement of root galls was also fastest at $25^{\circ}C$ and 2$0^{\circ}C$ but delayed at 15$^{\circ}C$ and 3$0^{\circ}C$ or above. Chinese cabbage seedlings with root gall formation showed reduction in number of leaves above ground fresh weight and amount of root hairs but increase in root weight, Root galls development was highest at soil moisture level of 80% of maximum soil moisture capacity than at 60% and 100%. Optimum soil pH for root gall development was pH 6 although root galls were formed at a range of pH 5 to 8. Period of light illumination also affected root gall development with the greatest gall development at 12hr/12hr in light/dark period and the least at 8hr/16hr. Site of root gall formation and gall shape did not differ greatly among treatments of temperature soil moisture pH and light experiments.

• 한국균학회소식:학술대회논문집
• /
• 한국균학회 2015년도 춘계학술대회 및 임시총회
• /
• pp.28-28
• /
• 2015

Clubroot disease caused by Plasmodiophora brassicae induces severe losses of cruciferous vegetables worldwide. To control clubroot of Chinese cabbage, many CR (clubroot resistance) F1 hybrid cultivars have been bred and released in Korea, China and Japan. In this study, we determined the race of P. brassicae 12 field isolates, which collected from 10 regions in Korea, using Williams' differential varieties including two cabbage ('Jersey Queen', 'Badger Shipper') and two rutabaga ('Laurentian', 'Whilhelmsburger'). By Williams' differential varieties, 12 clubroot pathogens were assigned into one (GN2), two (HS and YC), two (HN1 and HN2), three (DJ, KS and SS) and four (GS, GN1, JS and PC) isolates for races 1, 2, 4, 5 and 9, respectively. In addition, the degree of resistance of 45 CR cultivars that were from Korea, China and Japan was tested with the 12 isolates. The 45 CR cultivars of Chinese cabbage were differentiated into three genotypes according to their resistance responses. Even though the 12 P. brassicae isolates were same race by Williams' differential varieties, three CR genotypes showed different resistance response to the isolates. These results indicate that races of P. brassicae by Williams' differentials were not related with resistance of CR cultivars, and three CR genotypes represented qualitative resistance to the P. brassicae isolates. CR genotype I including 'CR-Cheongrok' showed resistance to GN1, GN2, JS, GS, HS, DJ and KS isolates and susceptibility to YC, PC, HN1, HN2 and SS isolates. And CR genotype II such as 'Hangkunjongbyungdaebaekchae' was resistant to GN1, GN2, JS, GS, HS, YC, PC and HN1 and susceptible to DJ, KS, SS and HN2. CR genotype III including 'Chunhajangkun' and 'Akimeki' represented resistance to 10 isolates except for SS and HN2 isolates. Based on these results, we selected 'CR-Cheongrok', 'Hangkunjongbyungdaebaekchae', and 'Chunhajangkun' as a representative cultivar of three CR genotypes and 'Norangkimjang' as a susceptible cultivar. Furthermore, we investigated the resistance of 15 lines of Chinese cabbage, which were provided by seed companies, to 11 isolates except for HN1 of P. brassicae. The results showed that three lines were susceptible to all the tested isolates, whereas five, four, and three lines represented the similar responses corresponding to the CR genotypes I, II, and III, respectively; there is no line of Chinese cabbage showing different resistance patterns compared to three CR genotypes. In particular, line 'SS001' showing resistance responses of CR genotype II was a parent of 'Saerona' that have been commercialized as a CR $F_1$ cultivar of Chinese cabbage. Together, we divided 12 isolates of P. brassicae into 4 races, designated by wild type, mutant type 1, mutant type 2, and mutant type 3. Wild type including GN1, GN2, JS, GS, and HS isolates of P. brassicae was not able to infect all the cultivars of three CR genotypes, whereas, mutant type 3 such as SS and HN2 isolates developed severe clubroot disease on all the CR genotype cultivars. To mutant type 1 including DJ and KS isolates, CR genotypes I, II and III were resistant, susceptible and resistant, respectively. In contrast, to mutant type 2 including YC, PS, and HN1 isolates, CR genotypes I, II and III showed susceptibility, resistance and resistance, respectively. Taken together, our results provide the extended knowledge of classification of P. brassicae races, which is useful information for the breeding of resistant crops, with a suggestion that 'Norangkimjang', 'CR-Cheongrok', 'Saerona' and 'Chunhajangkun' cultivars of Chinese cabbage could be used as new race differentials of P. brassicae for clubroot disease assay.

• 한국균학회소식:학술대회논문집
• /
• 한국균학회 2015년도 춘계학술대회 및 임시총회
• /
• pp.42-42
• /
• 2015

Plasmodiophora brassicae, the causal agent of clubroot disease, does the most serious damage to the Brassica crops. The limited control approaches make that the identification of clubroot resistance (CR) is more important for developing CR cultivars of the Brassica crops. So far, 8 CR loci were mapped. However, the variation of P. brassicae leads to the rapid erosion of its resistance. To identify novel CR genes, we employed three mapping population, derived from crosses between Chinese cabbage and turnip inbred lines ($59-1{\times}ECD04$ and $BJN3-1{\times}Siloga$) or between Chinese cabbage inbred lines ($BJN3-1{\times}85-I-II$), to perform QTL analysis. Totally, 8 CR loci were indentified and showed race-specific resistance. Physical mapping of these 8 loci suggested that 4 were located previously mapped position, indicating they might be the same allele or different alleles of the same genes. Other 4 loci were found to be novel. Further, CR near isogenic line carrying each CR locus was developed based on the marker assisted selection. Verification of these CR loci was underway. Identification of these novel CR genes would facilitate to breed broad-spectrum and durable CR cultivars of B. rapa by pyramiding strategies.

• Journal of Microbiology
• /
• 제39권1호
• /
• pp.56-61
• /
• 2001

Plasmodiophora brassicae is an obligate parasite, a causal organism of clubroot disease in crucifers that can survive in the soil as resting spores for many years. P. brassicae causes great losses in susceptible varieties of crucifers throughout the world. In this present study, an in planta molecular marker for the detection of P. bassicae was developed using an oligonucleotide primer set foam the small subunit gene (18S like) and internal transcribed spacer (ITS) region of rDNA. The specific primer sequences determined were TCAGCTTGAATGCTAATGTG (ITS5) and CTACCTCATTTGAGATCCTTTGA (PB-2). This primer set was used to specifically detect p. bassicae in planta. The amplicon using the specific primer set was about 1,000 bp. However, the test plant and other soil-borne fungi including Fusarium spp. and Rhizoctonia app., as well as bacteria such as Pseudomonas app. and Erwinia sup. did not show any reaction with the primer set.

• 한국식물병리학회:학술대회논문집
• /
• 한국식물병리학회 2002년도 총회 및 추계학술발표회
• /
• pp.70.2-70
• /
• 2002

• 식물병연구
• /
• 제9권2호
• /
• pp.57-63
• /
• 2003

Clubroot disease of curcifer crops caused by Plasmodiophora brassicae had been first reported in 1928 in Korea, and maintained mild occurrence until 1980s. Since 1990s the disease has become severe in alpine areas of Kyonggi and Kangwon, gradually spread to plain fields throughout the country, and remains as the great-est limiting factor for its production. Researches on the disease has begun in late 1990s after experiencing severe epidemics. Survey of occurrence and etiological studies have been carried out, particularly, on the pathogen physiology, race identification, quantification of soil pathogen population, and host spectrum of the pathogen. Ecology of gall formation and its decay, yield loss assessment associated with time of infection, and relationships between crop rotation and the disease incidence was also studied during late 1990s. In studies of its control, more than 200 crucifer cultivars were evaluated for their resistance to the disease. Lime applica-tion to field soil was also attempted to reduce the disease incidence. Resistant radish and welsh onion were recommended as rotation crops with crucifers after 3-year field experiments. However, so for, most studies on clubroot disease in Korea have been focused on chemical control. Two fungicides, fluazinam and flusulfamide, were selected and extensively studied on their application technologies and combination effects with lime application or other soil treatment. To develop environmentally-friendly control methods, solar-disinfection of soil, phosphoric acid as a nontoxic compound, and root-parasiting endophytes as biocontrol agents were examined for their effects on the disease in fields. In the future, more researches are needed to be done on development of resistant varieties effective to several races of the pathogen, establishment of economically-sound crop rotation system, and improvement of soil-disinfection technique applicable to Korean field condi-tion, and development of methodology of pretreatment of fungicides onto seeds and seedbeds.

• 농약과학회지
• /
• 제9권1호
• /
• pp.81-87
• /
• 2005

Ethaboxam[(RS)-N-(a-cyano-2-thenyl)-4-ethyl-2-(ethylamino)-1,3-thiazole-5-carboximide]은 난균강 미생물에 대하여 우수한 살균활성을 보이는 신규 살균제이다. Ethaboxam 원제와 몇 가지 ethaboxam 제형의 배추 뿌리혹병에 대한 방제효과를 조사하였다. Ethaboxam을 관주처리 하였을 때, 토양 1 L 당 8.33 mg 농도 처리구는 배추 뿌리의 혹 형성이 완전히 억제되었으며, $EC_{50}$ 값은 2.65 mg/L 토양이었다. Ethaboxam 5개 제형(10% 액상수화제, 15% 액상수화제, 2% 입제, 5% 입제, 25% 수화제) 그리고 ethaboxam과 metalaxyl 합제 제형(3%+1% 입제)의 배추 뿌리혹병 방제효과는 우수하였다. 이들 중 토양 관주처리 한 ethaboxam의 10% 및 15% 액상수화제, 토양 혼화처리 한 ethaboxam 2% 입제 제형은 다른 제형보다 배추 뿌리혹병에 대하여 더 우수한 방제효과를 보였다. 이들의 배추 뿌리혹병에 대한 $EC_{50}$ 값은 원제기준으로 토양 L 당 각각 3.72 mg(10% 액상수화제), 1.10 mg (15% 액상수화제), 4.95 mg (2% 입제) 이었다. 그러므로 실험한 ethaboxam 6개 제형 중에 15% 액상수화제가 배추 뿌리혹병에 대하여 가장 우수한 방제효과를 나타냄을 알 수 있었다. 이들 결과로부터 ethaboxam은 포장에서도 배추 뿌리혹병을 효과적으로 방제할 수 있으리라 생각되었다.

• 식물병연구
• /
• 제20권4호
• /
• pp.235-244
• /
• 2014

Brassica olerace의 주요 병해인 뿌리혹병과 시들음병에 대한 저항성 유전자원을 발굴하기 위하여, 농업유전자원정보센터로부터 제공받은 양배추(B. oleracea var capitata) 유전자원 60개와 브로콜리(B. oleracea var italica) 유전자원 6개의 뿌리혹병과 시들음병에 대한 저항성을 검정하였다. 유전자원의 뿌리혹병에 대한 저항성 검정을 위해서, 분양 받은 유전자원들의 유묘에 뿌리혹병균 Plasmodiophora brassicae의 포자현탁액을 접종하였다. 실험한 유전자원 중 양배추 유전자원 4개는 중도저항성을 보였으며, 이들 중 양배추 유전자원 'K166220'는 가장 높은 저항성을 나타냈다. 나머지 유전자원들은 감수성을 보였다. 한편, 유전자원의 시들음병에 대한 저항성을 검정하기 위하여 분양 받은 유전자원 유묘의 뿌리를 Fusarium oxysporum f. sp. conglutinans 포자 현탁액에 침지하여 접종하였다. 실험한 유전자원 중 양배추 유전자원 17개와 브로콜리 유전자원 5개는 저항성, 양배추 유전자원 16개는 중도저항성 그리고 나머지 유전자원은 감수성이었다. 특히 양배추 유전자원 3종('IT227115', 'K161791', 'K173350')과 브로콜리 유전자원 2종('IT227100', 'IT227099')은 시들음병에 대하여 높은 저항성을 보였다. 본 연구에서 확인된 뿌리혹병과 시들음병 저항성 유전자원들은 뿌리혹병과 시들음병 저항성 육종에 이용될 수 있을 것이다.