• Journal of the Korean Society of Food Science and Nutrition
• /
• v.24 no.1
• /
• pp.41-47
• /
• 1995

This experiments was designed to evaluated the chemical components and nutrition of Aspergillus fumigatus cells. This dried fungal mycellia was consist of crude protein 48.5%, crude lipid 2.9%, carbohydrate 44.7% and total ash 3.4%, respectively. The major fatty acid of total lipid were 27.9% of linoleic acid, 24.6% of oleic acid, 15.4% of palmitic acid and 10.6% of linolenic aicd. Amino acid analysis indicated that the protein was rich in aspartic acid, glutamic acid, leucine, lysine but poor in cystein, methionine, histidine. The fungal cake of Aspergillus fumigatus, when dried and specially processed, has been found to serve as a source of protein in place of soybean meal in the diet of experimental mice. Animal were fed a control diet first, and an incease in weight proved the formulation to be satisfactory. At the end of a 30-day period, the experimental mice showed increases in weight comparable to those of the control animals. The net protein efficiency ratio for the control diet was 3.42$\pm$0.15 and the fungal protein and succinylated fungal protein with DL-methionine they were 3.12$\pm$0.39 and 2.98$\pm$0.06 respectively. This supports the view that dried and succinylated fungal protein can be substituted as a protein source.

• Journal of the Korean Society of Food Science and Nutrition
• /
• v.20 no.2
• /
• pp.179-186
• /
• 1991

The nutritional requirement and cultural condition such as carbon and nitrogen sources, cultural temperature, initial pH, cultural time and aeration for the production of endocellular cytosine deaminase from Aspergillus fumigatus IFO 5840 were investigated. The cultural broth giving maximum cytosine deaminase yield was found to consist of 2% glucose as a carbon source and 1% yeast extract and 0.1% peptone as a nitrogen source. Optimal initial pH of the culture broth was pH 8.5 and the enzyme production in the cell usually reached a maximum after 28 hours of cultivation in the 500ml shaking flask containing 100ml broth at $30^{\circ}C$. The endoenzyme production of the used strain was inhibited by inorganic nitrogen, but activated by orgainc nitrogen, yeast extract.

• The Korean Journal of Mycology
• /
• v.46 no.4
• /
• pp.383-392
• /
• 2018

During the study of indigenous fungal communities in soil samples collected from various field soils in Sancheong, Gyeongsangnam-do, Korea in 2017, several species of Aspergillus were discovered. Aspergillus caninus (KNU17-7) was isolated, identified, and described based on the results from macro and micro morphological characteristics and molecular characterization. Morphologically, it was identified using five different growth media: potato dextrose agar, oatmeal agar, yeast extract sucrose agar, czapek yeast extract agar, and malt extract agar. For the molecular identification, sequencing of internal transcribed spacer, ${\beta}-tubulin$, and calmodulin genes was performed. Based on this characterization, our study isolate was identified as Aspergillus caninus. This fungal species has not been officially reported in Korea before, and we report here with its morphological and molecular phylogenetic characterization.

• Pediatric Infection and Vaccine
• /
• v.27 no.3
• /
• pp.190-197
• /
• 2020

Laryngotracheobronchitis (LTB) is a common disease in the pediatric population, and it is rarely caused by a fungal infection. Acute respiratory failure caused by fungal LTB mainly occurs in immunocompromised patients, and early diagnosis is closely associated with morbidity and mortality. However, an appropriate diagnosis is challenging for pediatricians because symptoms and signs of LTB caused by Aspergillus spp. are nonspecific. Here, we report a case of progressive respiratory failure caused by pseudomembranous LTB in a child with a suspicion of primary immunodeficiency and highlight the importance of an early investigation, especially in immunocompromised patients.

• Mycobiology
• /
• v.51 no.5
• /
• pp.288-299
• /
• 2023

Aspergillus is one of the largest and diverse genera of fungi with huge economical, biotechnological, and social significance. Taxonomically, Aspergillus is divided into six subgenera comprising 27 sections. In this study, 235 strains of Aspergillus subgenus Circumdati (section: Candidi, Circumdati, Flavi, Flavipedes, Nigri, and Terrei) preserved at the Korean Agricultural Culture Collection (KACC) were analyzed and re-identified using a combined dataset of partial b-tubulin (BenA), Calmodulin (CaM) gene sequences and morphological data. We confirmed nineteen species to be priorly reported in Korea (A. neotritici, A. terreus, A. floccosus, A. allahabadii, A. steynii, A. westerdijkiae, A. ochraceus, A. ostianus, A. sclerotiorum, A. luchuensis, A. tubingensis, A. niger, A. welwitschiae, A. japonicus, A. nomius, A. tamarii, A. parasiticus, A. flavi, and A. oryzae). Among the studied strains, three species (A. subalbidus, A. iizukae, and A. uvarum), previously unreported or not officially documented, were discovered in Korea, to the best of our knowledge. We have given a detailed description of the characteristic features of the three species, which remain uncharted in Korea.

• Microbiology and Biotechnology Letters
• /
• v.51 no.4
• /
• pp.457-464
• /
• 2023

Proteolytic enzymes produced by filamentous fungi can degrade various fibrous and globular proteins along with other metabolites that may also find application in biotechnology. In this study, the effect of proteolytic enzymes of 22 Aspergillus strains on various proteins was investigated using protein-containing diagnostic media. Subsequently, a new parameter estimating secreted proteinases specificity towards fibrous or globular proteins without its advanced biochemical research - index of severity of proteolytic action (ISPA) - was suggested. This index determines mycozymes specificity in following manner: its value increases with greater affinity to fibrous proteins, decreases if there is higher affinity to globular proteins. ISPA value was the lowest (0.52) for Aspergillus domesticus, indicating the highest specificity to globular proteins, the highest one (1.26) for A. glaucus, whose proteinases best hydrolyzed fibrous proteins. However, the highest overall proteolytic potential was observed for Aspergillus melleus. The ability to produce acid, alkali and extracellular pigments was evaluated for all isolated strains as well.

• Korean Journal of Microbiology
• /
• v.24 no.3
• /
• pp.204-210
• /
• 1986

One clone(pANt32) carring tRNA/sup Arg/ gene was selected from Aspergillus total tRNA gene clones. The nucleotide sequences of this tRNA gene were determined by Maxam and Gilbert's chemical cleavage methods. The sequence of this tRNA gene is as follow; 5'GGCCGGCTGCCCAATTGGCAAGGCGTCTGACTACGAATCAGGAGAT TGCAGGTTCGAGCCCTGCGTGGGTCA3'. This sequence conicides with the characteristecs of other eukaryotic tRNA. Some consensus sequences (ACT-TA bow, TATTTT and T-cluster) are found in both 5'-end and 3'-end flanking regions.

• Mycobiology
• /
• v.45 no.2
• /
• pp.119-122
• /
• 2017

Herein, nuruks derived from non-glutinous and glutinous rice inoculated with Aspergillus oryzae N159-1 (having high alpha-amylase and beta-glucosidase activities) were used to produce Korean alcoholic beverages. The resultant beverages had enhanced fruity (ethyl caproate and isoamyl alcohol) and rose (2-phenethyl acetate and phenethyl alcohol) flavors and high taste scores.

• Journal of Microbiology and Biotechnology
• /
• v.10 no.4
• /
• pp.518-521
• /
• 2000

Aspergillus niger is capable of metabolizing dimethyphthalate. The maximum weight of mycelium wa observed afterabout 6-8 dys of incubation. A TLC analysis revealed the accumulation of metabolites in the resting cell culture. Monomethylphthalate, phthalate, and protocatechuate were shown to be the intermediates by thin layer chromatographic and spectrophotometric analyses. The fungus metabolized dimethylphthalate through monomethylphthalate, phthalate, and protocatechuate as evidenced by the oxygen uptake and an enzymatic analysis. The terminal aromatic metabolite, protocatechuate, is metabolized via the ortho-cleavage pathway.

• Journal of Chest Surgery
• /
• v.12 no.3
• /
• pp.240-246
• /
• 1979

A 15-year-old boy having a small VSD was readmitted with clinical manifestations of acute endocarditis and aortic regurgitation one month after open heart surgery. In spite of vigorous treatment with broad-spectrum antibiotics, high fever persisted. Pseudomonas aeruginosa was isolated just one time among several blood cultures. Progressive pulmonary infarction due to embolization. Progressive congestive heart failure and D.I.C. caused patient`s death. Aspergillus was found in autopsy specimen.