• Proceedings of the Korean Institute of Information and Commucation Sciences Conference
• /
• 2022.05a
• /
• pp.377-380
• /
• 2022

An application called an app can be downloaded and used on mobile devices. Among them, Android-based apps have the disadvantage of being implemented on an open source basis and can be exploited by anyone, but unlike iOS, which discloses only a small part of the source code, Android is implemented as an open source, so it can analyze the code. However, since anyone can participate in changing the source code of open source-based Android apps, the number of malicious codes increases and types are bound to vary. Malicious codes that increase exponentially in a short period of time are difficult for humans to detect one by one, so it is efficient to use a technique to detect malicious codes using AI. Most of the existing malicious app detection methods are to extract Features and detect malicious apps. Therefore, three ways to select the optimal feature to be used for learning after feature extraction are proposed. Finally, in the step of modeling with optimal features, ensemble techniques are used in addition to a single model. Ensemble techniques have already shown results beyond the performance of a single model, as has been shown in several studies. Therefore, this paper presents a plan to select the optimal feature and implement a learning model for Android app-based malicious code detection.

• Journal of Microbiology
• /
• v.39 no.1
• /
• pp.56-61
• /
• 2001

Plasmodiophora brassicae is an obligate parasite, a causal organism of clubroot disease in crucifers that can survive in the soil as resting spores for many years. P. brassicae causes great losses in susceptible varieties of crucifers throughout the world. In this present study, an in planta molecular marker for the detection of P. bassicae was developed using an oligonucleotide primer set foam the small subunit gene (18S like) and internal transcribed spacer (ITS) region of rDNA. The specific primer sequences determined were TCAGCTTGAATGCTAATGTG (ITS5) and CTACCTCATTTGAGATCCTTTGA (PB-2). This primer set was used to specifically detect p. bassicae in planta. The amplicon using the specific primer set was about 1,000 bp. However, the test plant and other soil-borne fungi including Fusarium spp. and Rhizoctonia app., as well as bacteria such as Pseudomonas app. and Erwinia sup. did not show any reaction with the primer set.

• Journal of KIISE:Information Networking
• /
• v.31 no.4
• /
• pp.363-374
• /
• 2004

In this paper, we propose an in-line mode NIDS using network processors(NPs) that achieve performance comparable to ASIC and flexibility comparable to general-purpose processors. Even if many networking applications using NPs have been proposed, we cannot find any NP applications to NIDS in the literature. The proposed NIDS supports packet payload inspection detecting attacks, as well as packet filtering and traffic metering. In particular, we separate the filtering and metering functions from the complicated and time-consuming operations of the deep packet inspection function using two-level searching scheme, thus we can improve the performance, stability, and scalability of In-line mode system. We also implement a proto-type based on a PC platform and the Agere PayloadPlus (APP) 2.5G NP solution, and present a payload inspection algorithm to apply APP NP.

• Journal of KIISE
• /
• v.41 no.9
• /
• pp.707-714
• /
• 2014

In general, the benign apps transmit privacy information to the external to provide service to users as the malicious app does. In other words, the behavior of benign apps is similar to the one of malicious apps. Thus, the benign app can be easily manipulated for malicious purposes. Therefore, the malicious apps as well as the benign apps should notify the users of the possibility of privacy information leakage before installation to prevent the potential malicious behavior. In this paper, We propose the method to detect leakage of privacy information on the android app by analyzing API inter-dependency and shortest distance. Also, we present LeakDroid which detects leakage of privacy information on Android with the above method. Unlike dynamic approaches, LeakDroid analyzes Android apps on market site. To verify the privacy information leakage detection of LeakDroid, we experimented the well-known 250 malicious apps and the 1700 benign apps collected from Android Third party market. Our evaluation result shows that LeakDroid reached detection rate of 96.4% in the malicious apps and detected 68 true privacy information leakages inside the 1700 benign apps.

• Journal of Internet Computing and Services
• /
• v.14 no.4
• /
• pp.85-90
• /
• 2013

Currently, the electric fire prediction system uses PIC(Peripheral Interface Controller) for controller microprocessor. PIC has a slower computing speed than DSP does, so its real-time computing ability is inadequate. So with the basic characteristics waveform during arc generation as the standard reference, the comparison to this reference is used to predict and alarm electric fire from arc. While such alarm can be detected and taken care of from a remote central server, that prediction error rate is high and remote control in mobile environment is not available. In this article, the arc detection of time domain and frequency domain and wavelet-based adaptation algorithm executing the adaptation algorithm in conversion domain were applied to develop an electric fire prediction system loaded with new real-time arc detection algorithm using DSP. Also, remote control was made available through iPhone environment-based app development which enabled remote monitoring for arc's electric signal and power quality, and its utility was verified.

• Korean Journal of Veterinary Service
• /
• v.34 no.4
• /
• pp.313-320
• /
• 2011

The purpose of this study was to investigate association with gross lesions and causative pathogens of porcine respiratory disease complex (PRDC) including porcine circovirus type 2 (PCV2), porcine reproductive and respiratory syndrome virus (PRRSV), swine influenza virus (SIV), Mycoplasma hyopneumoniae (MH), Pasteurella multocida (PM), Actinobacillus pleuropneumoniae (APP), Haemophilus parasuis (HP) in slaughtered pigs. A total of 1,200 lung samples were collected randomly from slaughtered pigs in Korea during August of 2010 through July of 2011. The gross lesions were classified according to the six stages (0, 1~10, 11~20, 21~30, 31~40 and ${\geq}41$, unit=%) and 48 samples from each stage were selected to detect viral and bacterial pathogens. The results according to the six stages were 100 (8.3%), 259 (21.6%), 326 (27.2%), 213 (17.8%), 144 (12.0%) and 158 (13.2%) cases, respectively. Prevalence of pneumonia according to season was 87.0~96.7% and the highest prevalence was in spring. In detection of pathogens by PCR, 53 samples were not detected any causative pathogens of PRDC. PCV2, PRRSV, SIV, MH, PM, APP serotype 2, APP serotype 5 and HP were positive in 45.5%, 12.5%, 10.4%, 60.1%, 1.7%, 13.9%, 12.2% and 15.6%, respectively. In co-infection, PCV2-MH was the most detected causative pathogens of PRDC. The detection rate of PCV2 and PRRSV was the highest in spring, of SIV, MH and HP was in winter. The detection rate of APP-2 and APP-5 had no seasonal prevalence. The more severe gross lesions increased, the higher the detection rate showed.

• International Journal of Computer Science & Network Security
• /
• v.23 no.9
• /
• pp.141-149
• /
• 2023

Repacked mobile apps constitute about 78% of all malware of Android, and it greatly affects the technical ecosystem of Android. Although many methods exist for repacked app detection, most of them suffer from performance issues. In this manuscript, a novel method using the Constant Key Point Selection and Limited Binary Pattern (CKPS: LBP) Feature extraction-based Hashing is proposed for the identification of repacked android applications through the visual similarity, which is a notable feature of repacked applications. The results from the experiment prove that the proposed method can effectively detect the apps that are similar visually even that are even under the double fold content manipulations. From the experimental analysis, it proved that the proposed CKPS: LBP method has a better efficiency of detecting 1354 similar applications from a repository of 95124 applications and also the computational time was 0.91 seconds within which a user could get the decision of whether the app repacked. The overall efficiency of the proposed algorithm is 41% greater than the average of other methods, and the time complexity is found to have been reduced by 31%. The collision probability of the Hashes was 41% better than the average value of the other state of the art methods.

• Journal of Information Technology Services
• /
• v.15 no.2
• /
• pp.157-167
• /
• 2016

Task environment for enterprises and public institutions are moving into cyberspace-based environment and structing the LTE wireless network. The applications "App" operated in the LTE wireless network are mostly being developed with Android-based. But Android-based malwares are surging and they are the potential DDoS attacks. DDoS attack is a major information security threat and a means of cyber attacks. DDoS attacks are difficult to detect in advance and to defense effectively. To this end, a DMZ is set up in front of a network infrastructure and a particular server for defensive information security. Because There is the proliferation of mobile devices and apps, and the activation of android diversify DDoS attack methods. a DMZ is a limit to detect and to protect against DDoS attacks. This paper proposes an information security method to detect and Protect DDoS attacks from the terminal phase using a Preemptive military strategy concept. and then DDoS attack detection and protection app is implemented and proved its effectiveness by reducing web service request and memory usage. DDoS attack detection and protecting will ensure the efficiency of the mobile network resources. This method is necessary for a continuous usage of a wireless network environment for the national security and disaster control.

• International Journal of Computer Science & Network Security
• /
• v.24 no.4
• /
• pp.211-221
• /
• 2024

Pakistan is a top producer and exporter of high-quality rice, but traditional methods are still being used for detecting rice diseases. This research project developed an automated rice blast disease diagnosis technique based on deep learning, image processing, and transfer learning with pre-trained models such as Inception V3, VGG16, VGG19, and ResNet50. The modified connection skipping ResNet 50 had the highest accuracy of 99.16%, while the other models achieved 98.16%, 98.47%, and 98.56%, respectively. In addition, CNN and an ensemble model K-nearest neighbor were explored for disease prediction, and the study demonstrated superior performance and disease prediction using recommended web-app approaches.

• KSII Transactions on Internet and Information Systems (TIIS)
• /
• v.13 no.3
• /
• pp.1659-1673
• /
• 2019

Android platform provides In-app Billing service for purchasing valuable items inside mobile applications. However, it has become a major target for attackers to achieve valuable items without actual payment. Especially, application developers suffer from automated attacks targeting all the applications in the device, not a specific application. In this paper, we propose a novel scheme detecting automated attacks with probabilistic tests. The scheme tests the signature verification method in a non-deterministic way, and if the method was replaced by the automated attack, the scheme detects it with very high probability. Both the analysis and the experiment result show that the developers can prevent their applications from automated attacks securely and efficiently by using of the proposed scheme.