• 제목/요약/키워드: VIR

검색결과 83건 처리시간 0.022초

Agrobacterium tumefaciens A348에서 virE 프로모터의 활성 (Activity of virE promoter in Agrobacterium tumefaciens A348)

  • 음진성
    • Journal of Plant Biology
    • /
    • 제34권4호
    • /
    • pp.331-339
    • /
    • 1991
  • To elucidate the regulatory mechanism of virE operon from vir regions (virA, virB, virC, virD, virG, virE) of pTiA6 which have been known to be essential for efficient crown gall tumorigenesis in plants, the activity of the truncated virE, promoter was analyzed. pSM358cd, a recombinant plasmid in which virE :: Tn3-HoHo1 (Tn3-promoterless lacZ) was cloned into SalI site of pVK102, was digested with SalI, and virE :: Tn3-HoHo1 was seperated from pVK102. To construct the truncted virE recombinant plasmids (pJS031, pJS051, pJS102, pJS201, pJS301), 5'-end of vireE promoter was deleted with BAL31 and cloned into pVK102 and then transferred into a. tumefaciens A348(pTiA6). According to the activity of the truncated virE promoter in recombinant plasmids, they were classified into two groups, pJS031, pJS051, pJS101 and pJS201 belong to a functional group and pJS301 is a non-functional. The size of deleted nucleotides of pJS201 and pJS301 seemed to be about 130 nucleotides and about 250 nucleotides from 5'-end of virE promoter, respectively. Hence it was thought that the essential site of the virE promoter was located between about 130th nucleotide and 250th nucleotide from 5'-end of the virE promoter.

  • PDF

Agrobacterium tumefaciens pTiA6 플라스미드의 virE 프로모터내 조절부위의 구조적 특성 (Structural Characterization of the Regulatory Site in virE Promoter of Agrobacterium tumefaciens pTiA6 Plasmid)

  • 음진성
    • Journal of Plant Biology
    • /
    • 제35권2호
    • /
    • pp.155-163
    • /
    • 1992
  • 식물세포에 tumor를 유발하는 Agrobacterium tumefaciens pTiA6 plasmid에서 virE 유전자의 발현조절기작을 분자적수준에서 규명하기 위하여 virE promoter의 5'-말단을 제거하여 얻은 truncated virE 재조합플라스미드를 이용하여 virE promoter의 조절부위에 대하여 연구하였다. virE promoter의 기능이 존재하는 truncated virE 재조합플라스미드인 pJS201은 전기영동에 의하여 virE promoter의 5'-말단으로부터 약 130개의 염기가 제거된 것으로 측정되었다. 한편 virE promoter의 기능을 상실한 pJS301에서 dideoxy chain termination방법으로 truncated virE promoter 염기서열을 결정한 결과 263개의 염기가 제거된 것으로 확인되었다. 따라서 virE promoter의 조절부위는 virE promoter의 5'-말단으로부터 약 130번째의 염기에서 263번째의 염기사이에 존재하는 것으로 사료되며, 이 사이에 23개의 염기로 이루어진 역반복서열(AACTTTGCGCTATAGGCAAAGTT)이 존재하고 있는데, 이 부위가 virE operon의 발현에 있어서 RNA polymerase의 최초 인식부위(recognition site)일 것으로 사료된다.

  • PDF

여러 종류의 Agrobacterium tumefaciens에서 vir 유전자의 발현에 영향을 미치는 페놀화합물 (Influence of Phenolic Compounds on vir Gene Expression in Various Agrobacterium tumefaciens)

  • 음진성;박영두
    • 한국토양비료학회지
    • /
    • 제33권4호
    • /
    • pp.253-260
    • /
    • 2000
  • Agrobacterium tumefaciens에 존재하는 Ti 플라스미드의 virulence(vir)유전자들은 상처난 식물세포에서 분비되는 페놀화합물에 의해서 발현이 유도된다. 본 연구에서는 3종류의 A. tumefaciens들을 대상으로 8종의 페놀화합물들 중에서 vir유전자의 발현에 영향을 미치는 페놀 화합물들의 종류와 이들 균주에서 발현되는 vir유전자의 활성을 조사하였다. A. tumefaciens MW102에 존재하는 vir유전자는 4-hydroxyacetophenone, phenol, catechol, resorcinol과 vanillin등 5종류의 페놀화합물들에 의해서 높게 발현된 반면, 다른 A. tumefaciens Mw105와 Mw108의 vir유전자들은 이들 페놀화합물들에 의해서 매우 낮게 발현되거나 또는 발현되지 않았다. 또한 A. tumefaciens Mw102는 A. tumefaciens Mw105와 Mw108의 vir유전자를 매우 높게 발현시키는 acetosyringene에 의해서는 매우 낮게 발현되었다. 따라서 vir유전자의 발현을 유도시키는 능력은 Ti 플라스미드들의 종류와 페놀화합물들의 종류에 따라서 서로 다르다는 결과를 얻었다. 결과적으로 vir유전자 유도능력의 차이는 vir A 유전자에서 발현되는 sensor단백질의 차이 때문일 것으로 사료된다.

  • PDF

Mtatioal Analysis of the Role of vir-box in the Expression of the virE Gene

  • Han, Seong-Su;Sim, Woong-Seop
    • Journal of Microbiology
    • /
    • 제37권3호
    • /
    • pp.175-179
    • /
    • 1999
  • To elucidate the role of vir-box in the expression of the virE gene, the vir-box was modified by site-directed mutagenesis and tested for ${\beta}$-galactosidase activities. A, C, T T, A, C substitutions at -62, -63, and -65 positions, destroying the 5'-region of the vir-box and A T at position -55, destroying the 3'-region of the vir-box respectively, showed only 17% promoter activity. When the vir-box was modified to contain perfect dyad symmetry structure (DSR) by the substitutions T, G A, T at -60 an d-61 positions, ${\beta}$-glactosidase activity increased 302%. These results indicate that the 5' and 3'-region of vir-box as well as the imperfect DSR of the vir-box itself may play a very important role in the regulation of virE gene expression.

  • PDF

SAR/VIR FCC에서 삼각 트레이닝 도구에 의한 분류정확도 분포추세 평가: 태국의 송클라 호수 유역을 사례로 (Evaluating Distribution Trends of Classification Accuracy by Triangular Training Operator in SAR/VIR FCC : A Case Study of Songkhla Lake Basin in Thailand)

  • Jung Sup Um
    • 대한지리학회지
    • /
    • 제38권3호
    • /
    • pp.375-388
    • /
    • 2003
  • SAR와 VIR 영상을 디지털 환경에서 통합하여 상승효과를 도출하려는 응용은 아직까지도 탐색적인 연구수준에 머물러 있다. 본 연구는 SAR와 VIR을 통합한 영상에서 삼각 트레이닝 도구가 개별 클라스의 분류 정확도의 분포추세에 미치는 영향을 평가하는 데 주안점을 두고 있다. SAR 데이터와 VIR 데이터가 단일 시너지 영상을 제작하기 위해 통합되었다. 분류정확도의 향상과정이 SAR, VIR, SAR/VIR 통합영상에서 단계적으로 확실하게 도출되었다. 아울러 개별 클라스의 분류정확도가 FCC에 의거한 트레이닝 샘플의 신호(signature)값과 밀접한 상관성을 가지고 분포되는 것이 확인되었다. 한 예로 FCC에서 SAR 영상 신호(signature)의 기여 때문에 구름으로 덮힌 지역과 굴곡을 지닌 지상물체가 (VIR에서는 사실상 분류가 불가능하였던) 상당한 공간 정확도를 가지고 분류되었다. 본 연구가 SAR/VIR을 통합한 응용분야에서 분류정확도의 분포추세에 대한 정량화되고 객관적인 근거가 부재하여 직면하였던 한계를 극복할 수 있는 계기가 되어 향후 SAT/VIR 원격탐사에서 개별 클라스에 대해 확보할 수 있는 분류 정확도에 대한 중요한 참고자료가 될 수 있을 것으로 사료된다.

Population genetic analysis of Plasmodium vivax vir genes in Pakistan

  • Sylvatrie-Danne Dinzouna-Boutamba;Zin Moon;Sanghyun Lee;Sahib Gul Afridi;Huong Giang Le;Yeonchul Hong;Byoung-Kuk Na;Youn-Kyoung Goo
    • Parasites, Hosts and Diseases
    • /
    • 제62권3호
    • /
    • pp.313-322
    • /
    • 2024
  • Plasmodium vivax variant interspersed repeats (vir) refer to the key protein used for escaping the host immune system. Knowledge in the genetic variation of vir genes can be used for the development of vaccines or diagnostic methods. Therefore, we evaluated the genetic diversity of the vir genes of P. vivax populations of several Asian countries, including Pakistan, which is a malaria-endemic country experiencing a significant rise in malaria cases in recent years. We analyzed the genetic diversity and population structure of 4 vir genes (vir 4, vir 12, vir 21, and vir 27) in the Pakistan P. vivax population and compared these features to those of the corresponding vir genes in other Asian countries. In Pakistan, vir 4 (S=198, H=9, Hd=0.889, Tajima's D value=1.12321) was the most genetically heterogenous, while the features of vir 21 (S=8, H=7, Hd=0.664, Tajima's D value =-0.63763) and vir 27 (S =25, H =11, Hd =0.682, Tajima's D value=-2.10836) were relatively conserved. Additionally, vir 4 was the most genetically diverse among Asian P. vivax populations, although within population diversity was low. Meanwhile, vir 21 and vir 27 among all Asian populations were closely related genetically. Our findings on the genetic diversity of vir genes and its relationships between populations in diverse geographical locations contribute toward a better understanding of the genetic characteristics of vir. The high level of genetic diversity of vir 4 suggests that this gene can be a useful genetic marker for understanding the P. vivax population structure. Longitudinal genetic diversity studies of vir genes in P. vivax isolates obtained from more diverse geographical areas are needed to better understand the function of vir genes and their use for the development of malaria control measures, such as vaccines.

Mutational Analysis of the Region between vir Box and -35 Sequence in virE Promoter of pTiA6

  • Woong Seop Sim
    • Journal of Plant Biology
    • /
    • 제38권3호
    • /
    • pp.259-266
    • /
    • 1995
  • To investigate how the dyad symmetry region (DSR) and the distance between vir box and -35 sequence of the virE promoter plays a role in virE gene expression, two mutants were constructed by base substitution and insertional mutagenesis. The base substitutional mutation, a AAlongrightarrowCG substitution at positions -39 and -40 on the DSR, showed the level of $\beta$-galactosidase activity approximately 91% of the wild type virE promoter activity. Therefore, the native structure of the DSR seems to be not essential for virE expression. The insertional mutation, constructed by inserting 8 bp ClaI linker between -49 and -50, displayed the $\beta$-galactosidase activity at 12% of the native virE promoter activity. However, this striking reduction appears to be not caused by destruction of the native DSR structure, but by shifting the vir box far from putative -35 sequence.

  • PDF

Agrobacterium을 이용한 형질전환에서 sonication과 vir 유전자들의 효과 (Effect of Sonication and vir Genes on Transient Gene Expression in Agrobacterium-Mediated Transformation)

  • 이병무
    • 생명과학회지
    • /
    • 제11권4호
    • /
    • pp.316-320
    • /
    • 2001
  • Sonication tremendously improves the efficiency of Agrobacterium infection by introducing small and uniform fissures and channels throughout the targeted tissue. Using shoot tips of cotton as explants, the effect of sonication treatment and virulence genes in Agrobacterium tumefaciens on transformation efficiency was investigated. The pat gene which encodes resistance to the herbicide, glufosinate, was used as a selectable marker. Transformation efficiency was evaluated on th basis of survival rates of cocultivated shoot tips on selection medium containing 2.5 mg/l gulfosinate-ammonium(ppt) adn 25. mg/l Clavamax. Sonication from 5 to 15 second has a positive effect on shoop tip survival. However, whil virE as well as virG or vir GN54D showed an enhancement in transformation efficiency, virE,. virG resulted in the most significant enhancement. Overall, the combination of additional virG/virE gene and sonication treatment resulted in the most significant increase in transformation efficiency.

  • PDF

Agrobacterium tumefaciens와 Tumor-inducing 플라스미드에 의한 virulence 유전자의 발현 (Effects of Agrobacterium tumefaciens and Tumor-inducing plasmid on the virulence gene expression)

  • 음진성
    • 한국정보통신학회논문지
    • /
    • 제15권4호
    • /
    • pp.1000-1006
    • /
    • 2011
  • 본 연구에서는 vir유전자의 발현에 있어서 페놀화합물, Ti 플라스미드들의 종류(cctopine, nopaline), A. tumefaciens 들의 영향에 대해서 조사하였다. 9종류의 페놀화합물들을 3종류의 A. tumefaciens들과 3종류의 Ti 플라스미드들을 대상으로 조사하였다. Nopaline Ti 플라스미드를 포함하는 A. tumefaciens MW107에 존재하는 vir유전자는 4-hydroxyacetophenone, phenol, catechol, resorcinol, acetosyringone과 vanillin등 6종류의 페놀화합물들에 의해서 상대적으로 높게 발현되었다. Octopine Ti 플라스미드들을 포함하는 A. tumefaciens MW105와 MW108의 vir유전자들은 acetosyringone에서만 발현되었다. 따라서 vir유전자의 발현을 유도시키는 요인들은 Ti 플라스미드 종류, A. tumefaciens와 페놀화합물들의 종류에 따라서 서로 다르다는 결과를 얻었다.

한국산 Agrobacterium tumefaciens KU12so Ti-plasmid의 vir 유전자 발현 유도 물질 (Inducers for the vir Gene Expression of Ti-Plasmid in Korean Agrobacterium tumefaciens KU12)

  • 김준영
    • Journal of Plant Biology
    • /
    • 제34권3호
    • /
    • pp.245-251
    • /
    • 1991
  • In order to investigate the phenolic compounds inducing the expression of Ti-plasmid vir genes of Agrobacterium tumefaciens KU12, we tested whether the eighteen phenolic compounds known as vir gene inducer have the activity to induce vir operon of the Ti-plasmid in A. tumefaciens KU12 transformed with pSM358cd. Also, the phenolic compounds in some tumor-uninduced dicotyledons and the attachment ability of a. tumefaciens KU12 on such dicotyledonous plants were investigated in an effort to analyze the reason why no tumor is formed on the plants. As results, fifteen among eighteen phenolic compounds known as vir gene inducer induced the expression of the Ti-plasmid vir genes. Some dicotyledonous plants which do not form the tumor have the phenolic compounds inducing the vir genes, but have less ability of the attachment than the dicotyledonous plants forming tumor.

  • PDF