To elucidate the regulatory mechanism of virE operon from vir regions (virA, virB, virC, virD, virG, virE) of pTiA6 which have been known to be essential for efficient crown gall tumorigenesis in plants, the activity of the truncated virE, promoter was analyzed. pSM358cd, a recombinant plasmid in which virE :: Tn3-HoHo1 (Tn3-promoterless lacZ) was cloned into SalI site of pVK102, was digested with SalI, and virE :: Tn3-HoHo1 was seperated from pVK102. To construct the truncted virE recombinant plasmids (pJS031, pJS051, pJS102, pJS201, pJS301), 5'-end of vireE promoter was deleted with BAL31 and cloned into pVK102 and then transferred into a. tumefaciens A348(pTiA6). According to the activity of the truncated virE promoter in recombinant plasmids, they were classified into two groups, pJS031, pJS051, pJS101 and pJS201 belong to a functional group and pJS301 is a non-functional. The size of deleted nucleotides of pJS201 and pJS301 seemed to be about 130 nucleotides and about 250 nucleotides from 5'-end of virE promoter, respectively. Hence it was thought that the essential site of the virE promoter was located between about 130th nucleotide and 250th nucleotide from 5'-end of the virE promoter.
식물세포에 tumor를 유발하는 Agrobacterium tumefaciens pTiA6 plasmid에서 virE 유전자의 발현조절기작을 분자적수준에서 규명하기 위하여 virE promoter의 5'-말단을 제거하여 얻은 truncated virE 재조합플라스미드를 이용하여 virE promoter의 조절부위에 대하여 연구하였다. virE promoter의 기능이 존재하는 truncated virE 재조합플라스미드인 pJS201은 전기영동에 의하여 virE promoter의 5'-말단으로부터 약 130개의 염기가 제거된 것으로 측정되었다. 한편 virE promoter의 기능을 상실한 pJS301에서 dideoxy chain termination방법으로 truncated virE promoter 염기서열을 결정한 결과 263개의 염기가 제거된 것으로 확인되었다. 따라서 virE promoter의 조절부위는 virE promoter의 5'-말단으로부터 약 130번째의 염기에서 263번째의 염기사이에 존재하는 것으로 사료되며, 이 사이에 23개의 염기로 이루어진 역반복서열(AACTTTGCGCTATAGGCAAAGTT)이 존재하고 있는데, 이 부위가 virE operon의 발현에 있어서 RNA polymerase의 최초 인식부위(recognition site)일 것으로 사료된다.
Agrobacterium tumefaciens에 존재하는 Ti 플라스미드의 virulence(vir)유전자들은 상처난 식물세포에서 분비되는 페놀화합물에 의해서 발현이 유도된다. 본 연구에서는 3종류의 A. tumefaciens들을 대상으로 8종의 페놀화합물들 중에서 vir유전자의 발현에 영향을 미치는 페놀 화합물들의 종류와 이들 균주에서 발현되는 vir유전자의 활성을 조사하였다. A. tumefaciens MW102에 존재하는 vir유전자는 4-hydroxyacetophenone, phenol, catechol, resorcinol과 vanillin등 5종류의 페놀화합물들에 의해서 높게 발현된 반면, 다른 A. tumefaciens Mw105와 Mw108의 vir유전자들은 이들 페놀화합물들에 의해서 매우 낮게 발현되거나 또는 발현되지 않았다. 또한 A. tumefaciens Mw102는 A. tumefaciens Mw105와 Mw108의 vir유전자를 매우 높게 발현시키는 acetosyringene에 의해서는 매우 낮게 발현되었다. 따라서 vir유전자의 발현을 유도시키는 능력은 Ti 플라스미드들의 종류와 페놀화합물들의 종류에 따라서 서로 다르다는 결과를 얻었다. 결과적으로 vir유전자 유도능력의 차이는 vir A 유전자에서 발현되는 sensor단백질의 차이 때문일 것으로 사료된다.
To elucidate the role of vir-box in the expression of the virE gene, the vir-box was modified by site-directed mutagenesis and tested for ${\beta}$-galactosidase activities. A, C, T T, A, C substitutions at -62, -63, and -65 positions, destroying the 5'-region of the vir-box and A T at position -55, destroying the 3'-region of the vir-box respectively, showed only 17% promoter activity. When the vir-box was modified to contain perfect dyad symmetry structure (DSR) by the substitutions T, G A, T at -60 an d-61 positions, ${\beta}$-glactosidase activity increased 302%. These results indicate that the 5' and 3'-region of vir-box as well as the imperfect DSR of the vir-box itself may play a very important role in the regulation of virE gene expression.
SAR와 VIR 영상을 디지털 환경에서 통합하여 상승효과를 도출하려는 응용은 아직까지도 탐색적인 연구수준에 머물러 있다. 본 연구는 SAR와 VIR을 통합한 영상에서 삼각 트레이닝 도구가 개별 클라스의 분류 정확도의 분포추세에 미치는 영향을 평가하는 데 주안점을 두고 있다. SAR 데이터와 VIR 데이터가 단일 시너지 영상을 제작하기 위해 통합되었다. 분류정확도의 향상과정이 SAR, VIR, SAR/VIR 통합영상에서 단계적으로 확실하게 도출되었다. 아울러 개별 클라스의 분류정확도가 FCC에 의거한 트레이닝 샘플의 신호(signature)값과 밀접한 상관성을 가지고 분포되는 것이 확인되었다. 한 예로 FCC에서 SAR 영상 신호(signature)의 기여 때문에 구름으로 덮힌 지역과 굴곡을 지닌 지상물체가 (VIR에서는 사실상 분류가 불가능하였던) 상당한 공간 정확도를 가지고 분류되었다. 본 연구가 SAR/VIR을 통합한 응용분야에서 분류정확도의 분포추세에 대한 정량화되고 객관적인 근거가 부재하여 직면하였던 한계를 극복할 수 있는 계기가 되어 향후 SAT/VIR 원격탐사에서 개별 클라스에 대해 확보할 수 있는 분류 정확도에 대한 중요한 참고자료가 될 수 있을 것으로 사료된다.
Plasmodium vivax variant interspersed repeats (vir) refer to the key protein used for escaping the host immune system. Knowledge in the genetic variation of vir genes can be used for the development of vaccines or diagnostic methods. Therefore, we evaluated the genetic diversity of the vir genes of P. vivax populations of several Asian countries, including Pakistan, which is a malaria-endemic country experiencing a significant rise in malaria cases in recent years. We analyzed the genetic diversity and population structure of 4 vir genes (vir 4, vir 12, vir 21, and vir 27) in the Pakistan P. vivax population and compared these features to those of the corresponding vir genes in other Asian countries. In Pakistan, vir 4 (S=198, H=9, Hd=0.889, Tajima's D value=1.12321) was the most genetically heterogenous, while the features of vir 21 (S=8, H=7, Hd=0.664, Tajima's D value =-0.63763) and vir 27 (S =25, H =11, Hd =0.682, Tajima's D value=-2.10836) were relatively conserved. Additionally, vir 4 was the most genetically diverse among Asian P. vivax populations, although within population diversity was low. Meanwhile, vir 21 and vir 27 among all Asian populations were closely related genetically. Our findings on the genetic diversity of vir genes and its relationships between populations in diverse geographical locations contribute toward a better understanding of the genetic characteristics of vir. The high level of genetic diversity of vir 4 suggests that this gene can be a useful genetic marker for understanding the P. vivax population structure. Longitudinal genetic diversity studies of vir genes in P. vivax isolates obtained from more diverse geographical areas are needed to better understand the function of vir genes and their use for the development of malaria control measures, such as vaccines.
To investigate how the dyad symmetry region (DSR) and the distance between vir box and -35 sequence of the virE promoter plays a role in virE gene expression, two mutants were constructed by base substitution and insertional mutagenesis. The base substitutional mutation, a AAlongrightarrowCG substitution at positions -39 and -40 on the DSR, showed the level of $\beta$-galactosidase activity approximately 91% of the wild type virE promoter activity. Therefore, the native structure of the DSR seems to be not essential for virE expression. The insertional mutation, constructed by inserting 8 bp ClaI linker between -49 and -50, displayed the $\beta$-galactosidase activity at 12% of the native virE promoter activity. However, this striking reduction appears to be not caused by destruction of the native DSR structure, but by shifting the vir box far from putative -35 sequence.
Sonication tremendously improves the efficiency of Agrobacterium infection by introducing small and uniform fissures and channels throughout the targeted tissue. Using shoot tips of cotton as explants, the effect of sonication treatment and virulence genes in Agrobacterium tumefaciens on transformation efficiency was investigated. The pat gene which encodes resistance to the herbicide, glufosinate, was used as a selectable marker. Transformation efficiency was evaluated on th basis of survival rates of cocultivated shoot tips on selection medium containing 2.5 mg/l gulfosinate-ammonium(ppt) adn 25. mg/l Clavamax. Sonication from 5 to 15 second has a positive effect on shoop tip survival. However, whil virE as well as virG or vir GN54D showed an enhancement in transformation efficiency, virE,. virG resulted in the most significant enhancement. Overall, the combination of additional virG/virE gene and sonication treatment resulted in the most significant increase in transformation efficiency.
본 연구에서는 vir유전자의 발현에 있어서 페놀화합물, Ti 플라스미드들의 종류(cctopine, nopaline), A. tumefaciens 들의 영향에 대해서 조사하였다. 9종류의 페놀화합물들을 3종류의 A. tumefaciens들과 3종류의 Ti 플라스미드들을 대상으로 조사하였다. Nopaline Ti 플라스미드를 포함하는 A. tumefaciens MW107에 존재하는 vir유전자는 4-hydroxyacetophenone, phenol, catechol, resorcinol, acetosyringone과 vanillin등 6종류의 페놀화합물들에 의해서 상대적으로 높게 발현되었다. Octopine Ti 플라스미드들을 포함하는 A. tumefaciens MW105와 MW108의 vir유전자들은 acetosyringone에서만 발현되었다. 따라서 vir유전자의 발현을 유도시키는 요인들은 Ti 플라스미드 종류, A. tumefaciens와 페놀화합물들의 종류에 따라서 서로 다르다는 결과를 얻었다.
In order to investigate the phenolic compounds inducing the expression of Ti-plasmid vir genes of Agrobacterium tumefaciens KU12, we tested whether the eighteen phenolic compounds known as vir gene inducer have the activity to induce vir operon of the Ti-plasmid in A. tumefaciens KU12 transformed with pSM358cd. Also, the phenolic compounds in some tumor-uninduced dicotyledons and the attachment ability of a. tumefaciens KU12 on such dicotyledonous plants were investigated in an effort to analyze the reason why no tumor is formed on the plants. As results, fifteen among eighteen phenolic compounds known as vir gene inducer induced the expression of the Ti-plasmid vir genes. Some dicotyledonous plants which do not form the tumor have the phenolic compounds inducing the vir genes, but have less ability of the attachment than the dicotyledonous plants forming tumor.
본 웹사이트에 게시된 이메일 주소가 전자우편 수집 프로그램이나
그 밖의 기술적 장치를 이용하여 무단으로 수집되는 것을 거부하며,
이를 위반시 정보통신망법에 의해 형사 처벌됨을 유념하시기 바랍니다.
[게시일 2004년 10월 1일]
이용약관
제 1 장 총칙
제 1 조 (목적)
이 이용약관은 KoreaScience 홈페이지(이하 “당 사이트”)에서 제공하는 인터넷 서비스(이하 '서비스')의 가입조건 및 이용에 관한 제반 사항과 기타 필요한 사항을 구체적으로 규정함을 목적으로 합니다.
제 2 조 (용어의 정의)
① "이용자"라 함은 당 사이트에 접속하여 이 약관에 따라 당 사이트가 제공하는 서비스를 받는 회원 및 비회원을
말합니다.
② "회원"이라 함은 서비스를 이용하기 위하여 당 사이트에 개인정보를 제공하여 아이디(ID)와 비밀번호를 부여
받은 자를 말합니다.
③ "회원 아이디(ID)"라 함은 회원의 식별 및 서비스 이용을 위하여 자신이 선정한 문자 및 숫자의 조합을
말합니다.
④ "비밀번호(패스워드)"라 함은 회원이 자신의 비밀보호를 위하여 선정한 문자 및 숫자의 조합을 말합니다.
제 3 조 (이용약관의 효력 및 변경)
① 이 약관은 당 사이트에 게시하거나 기타의 방법으로 회원에게 공지함으로써 효력이 발생합니다.
② 당 사이트는 이 약관을 개정할 경우에 적용일자 및 개정사유를 명시하여 현행 약관과 함께 당 사이트의
초기화면에 그 적용일자 7일 이전부터 적용일자 전일까지 공지합니다. 다만, 회원에게 불리하게 약관내용을
변경하는 경우에는 최소한 30일 이상의 사전 유예기간을 두고 공지합니다. 이 경우 당 사이트는 개정 전
내용과 개정 후 내용을 명확하게 비교하여 이용자가 알기 쉽도록 표시합니다.
제 4 조(약관 외 준칙)
① 이 약관은 당 사이트가 제공하는 서비스에 관한 이용안내와 함께 적용됩니다.
② 이 약관에 명시되지 아니한 사항은 관계법령의 규정이 적용됩니다.
제 2 장 이용계약의 체결
제 5 조 (이용계약의 성립 등)
① 이용계약은 이용고객이 당 사이트가 정한 약관에 「동의합니다」를 선택하고, 당 사이트가 정한
온라인신청양식을 작성하여 서비스 이용을 신청한 후, 당 사이트가 이를 승낙함으로써 성립합니다.
② 제1항의 승낙은 당 사이트가 제공하는 과학기술정보검색, 맞춤정보, 서지정보 등 다른 서비스의 이용승낙을
포함합니다.
제 6 조 (회원가입)
서비스를 이용하고자 하는 고객은 당 사이트에서 정한 회원가입양식에 개인정보를 기재하여 가입을 하여야 합니다.
제 7 조 (개인정보의 보호 및 사용)
당 사이트는 관계법령이 정하는 바에 따라 회원 등록정보를 포함한 회원의 개인정보를 보호하기 위해 노력합니다. 회원 개인정보의 보호 및 사용에 대해서는 관련법령 및 당 사이트의 개인정보 보호정책이 적용됩니다.
제 8 조 (이용 신청의 승낙과 제한)
① 당 사이트는 제6조의 규정에 의한 이용신청고객에 대하여 서비스 이용을 승낙합니다.
② 당 사이트는 아래사항에 해당하는 경우에 대해서 승낙하지 아니 합니다.
- 이용계약 신청서의 내용을 허위로 기재한 경우
- 기타 규정한 제반사항을 위반하며 신청하는 경우
제 9 조 (회원 ID 부여 및 변경 등)
① 당 사이트는 이용고객에 대하여 약관에 정하는 바에 따라 자신이 선정한 회원 ID를 부여합니다.
② 회원 ID는 원칙적으로 변경이 불가하며 부득이한 사유로 인하여 변경 하고자 하는 경우에는 해당 ID를
해지하고 재가입해야 합니다.
③ 기타 회원 개인정보 관리 및 변경 등에 관한 사항은 서비스별 안내에 정하는 바에 의합니다.
제 3 장 계약 당사자의 의무
제 10 조 (KISTI의 의무)
① 당 사이트는 이용고객이 희망한 서비스 제공 개시일에 특별한 사정이 없는 한 서비스를 이용할 수 있도록
하여야 합니다.
② 당 사이트는 개인정보 보호를 위해 보안시스템을 구축하며 개인정보 보호정책을 공시하고 준수합니다.
③ 당 사이트는 회원으로부터 제기되는 의견이나 불만이 정당하다고 객관적으로 인정될 경우에는 적절한 절차를
거쳐 즉시 처리하여야 합니다. 다만, 즉시 처리가 곤란한 경우는 회원에게 그 사유와 처리일정을 통보하여야
합니다.
제 11 조 (회원의 의무)
① 이용자는 회원가입 신청 또는 회원정보 변경 시 실명으로 모든 사항을 사실에 근거하여 작성하여야 하며,
허위 또는 타인의 정보를 등록할 경우 일체의 권리를 주장할 수 없습니다.
② 당 사이트가 관계법령 및 개인정보 보호정책에 의거하여 그 책임을 지는 경우를 제외하고 회원에게 부여된
ID의 비밀번호 관리소홀, 부정사용에 의하여 발생하는 모든 결과에 대한 책임은 회원에게 있습니다.
③ 회원은 당 사이트 및 제 3자의 지적 재산권을 침해해서는 안 됩니다.
제 4 장 서비스의 이용
제 12 조 (서비스 이용 시간)
① 서비스 이용은 당 사이트의 업무상 또는 기술상 특별한 지장이 없는 한 연중무휴, 1일 24시간 운영을
원칙으로 합니다. 단, 당 사이트는 시스템 정기점검, 증설 및 교체를 위해 당 사이트가 정한 날이나 시간에
서비스를 일시 중단할 수 있으며, 예정되어 있는 작업으로 인한 서비스 일시중단은 당 사이트 홈페이지를
통해 사전에 공지합니다.
② 당 사이트는 서비스를 특정범위로 분할하여 각 범위별로 이용가능시간을 별도로 지정할 수 있습니다. 다만
이 경우 그 내용을 공지합니다.
제 13 조 (홈페이지 저작권)
① NDSL에서 제공하는 모든 저작물의 저작권은 원저작자에게 있으며, KISTI는 복제/배포/전송권을 확보하고
있습니다.
② NDSL에서 제공하는 콘텐츠를 상업적 및 기타 영리목적으로 복제/배포/전송할 경우 사전에 KISTI의 허락을
받아야 합니다.
③ NDSL에서 제공하는 콘텐츠를 보도, 비평, 교육, 연구 등을 위하여 정당한 범위 안에서 공정한 관행에
합치되게 인용할 수 있습니다.
④ NDSL에서 제공하는 콘텐츠를 무단 복제, 전송, 배포 기타 저작권법에 위반되는 방법으로 이용할 경우
저작권법 제136조에 따라 5년 이하의 징역 또는 5천만 원 이하의 벌금에 처해질 수 있습니다.
제 14 조 (유료서비스)
① 당 사이트 및 협력기관이 정한 유료서비스(원문복사 등)는 별도로 정해진 바에 따르며, 변경사항은 시행 전에
당 사이트 홈페이지를 통하여 회원에게 공지합니다.
② 유료서비스를 이용하려는 회원은 정해진 요금체계에 따라 요금을 납부해야 합니다.
제 5 장 계약 해지 및 이용 제한
제 15 조 (계약 해지)
회원이 이용계약을 해지하고자 하는 때에는 [가입해지] 메뉴를 이용해 직접 해지해야 합니다.
제 16 조 (서비스 이용제한)
① 당 사이트는 회원이 서비스 이용내용에 있어서 본 약관 제 11조 내용을 위반하거나, 다음 각 호에 해당하는
경우 서비스 이용을 제한할 수 있습니다.
- 2년 이상 서비스를 이용한 적이 없는 경우
- 기타 정상적인 서비스 운영에 방해가 될 경우
② 상기 이용제한 규정에 따라 서비스를 이용하는 회원에게 서비스 이용에 대하여 별도 공지 없이 서비스 이용의
일시정지, 이용계약 해지 할 수 있습니다.
제 17 조 (전자우편주소 수집 금지)
회원은 전자우편주소 추출기 등을 이용하여 전자우편주소를 수집 또는 제3자에게 제공할 수 없습니다.
제 6 장 손해배상 및 기타사항
제 18 조 (손해배상)
당 사이트는 무료로 제공되는 서비스와 관련하여 회원에게 어떠한 손해가 발생하더라도 당 사이트가 고의 또는 과실로 인한 손해발생을 제외하고는 이에 대하여 책임을 부담하지 아니합니다.
제 19 조 (관할 법원)
서비스 이용으로 발생한 분쟁에 대해 소송이 제기되는 경우 민사 소송법상의 관할 법원에 제기합니다.
[부 칙]
1. (시행일) 이 약관은 2016년 9월 5일부터 적용되며, 종전 약관은 본 약관으로 대체되며, 개정된 약관의 적용일 이전 가입자도 개정된 약관의 적용을 받습니다.