• 한국한의학연구원논문집
• /
• 제1권1호
• /
• pp.401-418
• /
• 1995

Aging process can be explained by many factors. In this study, we counted complete Blood Cells (CBC) such as WBC, Lymphocytes, Monocytes, Granulocytes, RBC, HGB, and HCT of both SAM P6 and SAM P1 during the aging process. Plasma albumin, glucose, alkaline phosphatase, calcium, creatinine, inorganic phosphate, urea concentrations were also measured at the same time. In addition to these, plasma concentrations of cortisol, total T3, and total T4 were analyzed by Chemiluminescent Immunoassay. There were no change in CBC counts of SAM R1 and SAM P6 during this study. Plasma concentratins of albumin and glucose decreased significantly in SAM R1. However, plasma alkaline phosphatases and creatinine concentration in SAM P6 decreased significantly at 16 week after birth comparing to the control. Total T4 levels were siginificantly increased although cortisol and total T3 concentrations were the same in SAM R1 groups. Especially, the after birth of creatinine, alkaline phosphatase, T4 of SAM P6 at 16 week were significantly different form those of SAM R1. At 12 week after birth, pilose antler extract was given 5g/kg/day p.o. for 0, 7, 14, 21, and 30 days each in both SAM R1 and SAM P6. The RBC, HGB, and HCT levels started to increase significantly from 7 days after the dose at SAM P6 only. Total T4 conectrations were elevated gradually during the study although the antler extract administration did not prevent or inhibit the increase in total T4 concentration during the study. Therefore, the elevation of erythrocytes after administration of the extract needs to be studied in future.

• Asian-Australasian Journal of Animal Sciences
• /
• 제14권10호
• /
• pp.1405-1408
• /
• 2001

Ca salt of soybean oil (PSO) and that of mustard oil plus mahua oil (PMOMO) (50:50) were prepared using double decomposition method, and further tested for their fatty acid composition and degree of saponification. Furthermore, the different levels of protected fat of PSO and PMOMO were evaluated in wheat straw based total mixed ration (TMR) in vitro. Results indicated that capric, lauric, myristic, palmitic, steric, oleic, linoleic, leinolenic acids were traces, traces, traces, 10.00, 2.00, 25.00, 58.50, 5.0% in PSO while the corresponding values in PMOMO were 1.08, 0.28, 0.45, 16.9, 12.95, 44.38, 17.46 and 6.50%, respectively. The degree of saponification of both protected fat supplements was more than 80%. Six treatment combinations were tested I.e., blank without feed and fat supplement (T1); control diet with out fat supplement (T2); control diet plus bypass fat supplement (PSO) so that diet contain 5% fat (T3); control diet plus bypass fat supplement (PSO) so that diet contain 7.5% fat (T4); two more diets viz. T5 and T6 were formulated using bypass fat supplement from PMOMO containing 5 and 7.5% fat respectively. TMR was prepared using 50% concentrate mixture and 50% wheat straw. Result indicated that TVFA, $NH_3-N$,TCA-N, total-N and total gas production were increased in treatment diets at 7.5% level of supplementation, however, fermentation pattern remain similar at 5.0% level of supplementation with respect to control diet. Nevertheless, IVDMD and IVOMD values remained unchanged, rather non-significant at both fat levels and with the both fat sources. On the basis of results it was concluded that Ca-salt of Soybean oil or Mustard plus Mahua oil did not show any negative effect either on digestibility or on microbial protein synthesis in rumen, hence the dietary fat upto 7.5% level in total mixed ration based on wheat straw, could be safely used without any adverse effect on rumen fermentation.

• 한국농공학회지
• /
• 제31권3호
• /
• pp.93-102
• /
• 1989

With an objective to provide basic information for the management and the prediction of eutrophication in lentic water Systems, total amount of Kjeldahl nitrogen(T-N) and phosphorous(T-P) from irrigated water and drained water from flooded paddies were investigated during the rice growing period of 1988. A 29.3 ha paddies near Jungnam-myun, HwaSung-gun, Gyungi Province, Korea was instrumented for measuring runoff and sampling irrigated water and drained water from paddies. The following conclusions may be drawn from the result of this study. 1.During 115 days of investigation, T-N load for paddies was 362.6kg and T-P 63.44kg.These would be converted to 12.4kg T-N/ha and 2.17kg T-P/ha, respectively. 2.The T-N and T-P loadings in different periods showed a significant difference. The 25% of T-N loading was drained soon after fertilization period and 60% was drained during the rainy season from July 5 to July 24. 3.Annual loadings from paddies could be calculated to 30kg T-N/ha/year and 52kg T-P/ha/year considering non-measurement periods. 4.After the rainy season, the nutrient loads from drained water showed much less than those from irrigated water, and it may be suggested that the paddies would act as a stabilization pond. 5.The average concentrations of nutrients at 0.9km downstream from investigated paddies were 2.02(T-N) mg/l and 0.52(T-P) mg/I, which were 1.82(T-N) mg/l and 0.056(T-P)mg/l lower than those of drained water from paddies.

• 보건교육건강증진학회지
• /
• 제25권3호
• /
• pp.95-109
• /
• 2008

Objectives: The study was conducted to investigate visual display terminal(VDT) and related risk factors in office workers. Method: The study subjects were 539 officers at 3 places of business in Gwangju. The data were collected by self-administered questionnaire between October 12 and October 17, 2007. and they agreed to participate in this study. The tool was developed by Moon, Jaedong(1991) for VDT syndrome. Data analysis by using SPSS/win 10.0 was performed with descriptive statistics, t-test and ANOVA. Results: The summary of results is as follows: 1) The mean score of total VDT syndrome was $1.17{\pm}.65$ of full score 4.00, which was lower than other research. 2) For relation between general characteristics and total VDT, sex (t=-5.777, p=.000), age (F=3.516, p=.015), satisfaction of job (F=9.540, p=.000), self-awareness of health (F=25.015, p=.000) had statistically significant difference. 3) For relation between behavioral work factors and total VDT, break time of work(t=-5.363, p=.000), eye movement during computer work(t=2.176, p=.031), wrist exercise during(t=2.337, p=.020), distance between monitor and eyes(F=3.682, p=.012) had statistically significant difference. 3) For relation between environmental work factors and total VDT, height of chair(F=8.801, p=.000), space under desk(F=4.244, p=.015), reflection of monitor(t=2.697, p=.008) had statistically significant difference. Conclusion: To prevent and relieve VDT syndrome and musculoskeletal disorders in office workers, it is important to teach good posture and stretching exercise during work.

• 한국물환경학회지
• /
• 제24권1호
• /
• pp.69-77
• /
• 2008

This study was conducted to know the characteristics of agricultural non-point source pollutants runoff by rainfall events at the upper catchment of Goseong reservoir in Gonjy city, Chungnam Province. For this study, the monitoring sites of the research catchment were set nineteen during the research period (between June 2005 and October 2006). Average runoff coefficient were observed 0.51 in 2005, 0.71 in 2006, respectively. The correlation coefficient (r) between the rainfall and peak-flow was investigated 0.787. By rainfall events, the water quality of the sites were shown like this : BOD 0.555~9.60 mg/L, T-N 0.01~13.50 mg/L, T-P 0.002~2.952 mg/L, and SS N.D~820.0 mg/L. The strong rainfall intensity was the most important factor of the soil erosion. The gabs of the arithmetic mean concentrations and the flow weighted mean concentrations were observed as the followings : BOD 0.0~29.2%, T-N 0.1~11.4%, T-P 0.4~95.2%, and SS 1.7~57.0% in 2005, and BOD 1.0~11.9%, T-N 0.7~7.3%, T-P 9.9~36.5%, and SS 6.6~36.5% in 2006, respectively. The BOD pollution load was 2,117 kg (36% of the total BOD loading of survey periods) while, T-N was 3,209.0 kg (27.9% of the total T-N loading of survey periods), T-P was 136.4 kg (37.4% of the total T-P loading of survey periods) and SS was 72,733.8 kg (51.8% of the total SS loading of survey periods) in the year 2005. In case of 2006, BOD load was 1,321.7, T-N was 2,845.8, T-P was 42.9, and SS was 16,275.8 kg, respectively.

• 한국농공학회:학술대회논문집
• /
• 한국농공학회 1999년도 Proceedings of the 1999 Annual Conference The Korean Society of Agricutural Engineers
• /
• pp.657-662
• /
• 1999

This study was conducted for the purpose of assessing the pollutant removal possibilities of sedimentation pool formed by deep dredging of a reservir inlet. Water quality data were collected in the Masan reservoir, whose inlet has been dredged deep like sedimentation pool. The average concentration of chemical oxygen demand(COD), total nitrogen(T-N) adnd total phosphorous(T-P) in the deep dredged area were 8.3∼28.4mg/$\ell$ (COD), 2.0∼6.0mg/$\ell$(T-N), 0.17∼1.34mg/$\ell$(T-P), which were 3.3% (COD) , 30.6%(T-N) and 46.4%(T-P) higher than those of middle part of the reservoir. From these results, it was considered the deep dredged area in the inlet of reservoir might play a key role to improve reservoir water quality.

• 한국버섯학회지
• /
• 제12권4호
• /
• pp.367-370
• /
• 2014

총탄소함량은 T4를 제외한 모든 처리구에서 대등하였으며, 총질소함량은 T3에서 2.17%로 대조구에 가장 근접한 값을 나타내었다. C/N율은 T4에서 39로 다른 처리구보다 높았다. 혼합배지에 따른 자실체의 생육특성을 조사한 결과 갓직경은 T2에서 가장 컸고, 대직경은 T2와 T4에서 가장 컸고, 대길이는 T1과 T2에서 가장 많았다. 유효경수는 T1과 T3에서 가장 많았다. 혼합배지에 따른 처리구별 수량은 T3에서 171g/병으로 대조구와 대등하였고, 회수율도 89.2%로 대조구와 대등한 결과를 나타내었다.

• 미생물학회지
• /
• 제24권3호
• /
• pp.204-210
• /
• 1986

One clone(pANt32) carring tRNA/sup Arg/ gene was selected from Aspergillus total tRNA gene clones. The nucleotide sequences of this tRNA gene were determined by Maxam and Gilbert's chemical cleavage methods. The sequence of this tRNA gene is as follow; 5'GGCCGGCTGCCCAATTGGCAAGGCGTCTGACTACGAATCAGGAGAT TGCAGGTTCGAGCCCTGCGTGGGTCA3'. This sequence conicides with the characteristecs of other eukaryotic tRNA. Some consensus sequences (ACT-TA bow, TATTTT and T-cluster) are found in both 5'-end and 3'-end flanking regions.

• 대한한방내과학회지
• /
• 제28권1호
• /
• pp.12-24
• /
• 2007

Objective : To investigate the effect of Samilshinkihwan(SISKW) on white rats with deteriorated immunity caused by methotrexate. Methods : The test articles were dosed once a day for 14 days by gastric gavage at a dosage 1000, 500 and 250mg/kg/10ml of SISKW from 2 days after last MTX-dosing, and changes in body weight, spleen weight, total blood leukocyte numbers, total lymphocyte numbers, B and T lymphocyte ratio, CD3+CD4+, CD3+/CD8+ and CD4+/CD8+ T lymphocyte ratio in the blood and spleen were measured. In addition, the serum interleukin (IL)-2 levels and the productivity of IL-2 of splenic cells were also demonstrated in this study. Results : The changes on body weight increased significantly in the 1000mg/kgof SISKW group. The changes on the spleen weight, the total blood leukocytenumbers, the total lymphocyte numbers in the blood and spleen, the ratio of T-cell in the blood and spleen and the ratio of CD3+CD4+ T-cell in spleen increased significantly in all SISKW groups as compared with the control group. The ratio of CD4+/CD8+ T-cells in blood increased significantly. The serum IL-2 levels and productivity of IL-2 of splenic cells increased significantly in 1000 and 500mg/kg SISKW groups as compared with the control group. Conclusions : Samilshinkihwanhas an effect of increasing immune responses, especially on cellular immune responses, in white rats with deteriorated immunity caused by methotrexate.

• 대한핵의학회지
• /
• 제19권1호
• /
• pp.113-117
• /
• 1985

The present study was undertaken to examine serum concentration of free $T_3,\;T_4$, in various functional states of the thyroid by Amerlex RIA kit method, which uses unidentified $T_3,\;T_4-labelled$ analogues, said to be unreactive with $T_3,\;T_4-binding$ proteins in serum, together with an antibody that binds both analogue and $T_3,\;T_4$. The test method has been compared with free $T_4$ index, which was product of total serum thyroxine and $T_3$ resin uptake ratio. Free $T_4$ value by this method was found to have a highly significant positive correlation with a free $T_4$ index (r; 0.957, p<0.005) and total $T_4$ (r:0.89, p<0.005) also, it was similar to other free $T_4$ measuring methods previously reported. So, it was showen to have the clinical utility as the screening test for thyroid function because it was a rapid; convinient, and reliable method for quantifying the free $T_4,\;T_3$ concentration in various thyroidal functional states.