• Journal of Microbiology and Biotechnology
• /
• 제9권2호
• /
• pp.184-190
• /
• 1999

The use of the polymerase chain reaction (PCR) method was described using two sets of primers based on the ceuN gene (JEJ 1 and JEJ 2) which encodes a protein involved in siderophore transport and 16S rRNA gene (pA and pB) for the sensitive and specific detection of enteropathogen Campylobacter jejuni. Six oligonucleotides were utilized in an amplification experiment and PCR products of predicted sizes were generated from whole cells and boiled cell lysates at the same intensity. Two sets of the primer pairs, JEJ and pAB, were specific enough for all C. jejuni strains tested for the direct use of whole cells without DNA extraction or lysis steps. In the PCR using the pAB primer pair, the detection limit, as determined by the ethidium bromide staining of the amplification products on agarose gels, was at the level of $10^1$ bacteria cells or less in both the pure culture and artificially inoculated milk and chicken enrichment samples, whereas the detection limit with the JEJ primer pair was relatively low, i.e. $10^3$ cells or more in the same PCR samples. The PCR method using either a primer JEJ or pAB was both repeatable and specific for the detection of C. jejuni in food. This method is simply completed within 4 h.

• Journal of Microbiology and Biotechnology
• /
• 제16권5호
• /
• pp.724-730
• /
• 2006

A sequence characterized amplified region (SCAR) marker, which was tightly linked with the A1 mating type locus in Phytophthora infestans, was developed. During the random amplified polymorphic DNA-based phylogenic studies of 33 isolates of P infestans collected from year 2002 to 2004, we found an A1 mating type-specific DNA fragment. This 573-bp DNA fragment was generated only in the genomic DNA of the A1 mating types, when OPC-5 primer was used. Based on the specific DNA sequence, we designed the primer sets for generating the A1 mating type-specific 569-bp DNA fragment. When 33 genomic DNAs of P. infestans were subjected to PCR amplification using different primer combinations, the A1 mating type-specific DNA was amplified, when LB-1F and LB-2R primers were used. The specific 569-bp DNA fragment was generated only from all 18 A1 strains, but not from 15 A2 mating type strains. These results corresponded to the mating type discriminating bioassay of 33 isolates of P. infestans. Therefore, the primer combination of LB-1F/LB2R was chosen as a SCAR marker. Overall, this study indicates that the SCAR marker could be developed into a useful tool for mating type determination of P. infestans.

• Journal of Microbiology and Biotechnology
• /
• 제27권5호
• /
• pp.909-915
• /
• 2017

Bifidobacterium bifidum BGN4 (BGN4) has many proven beneficial effects, including antiallergy and anticancer properties. It has been commercialized and used in several probiotic products, and thus strain-specific identification of this strain is very valuable for further strain-dependent physiological study. For this purpose, we developed novel multiplex polymerase chain reaction (PCR) primer sets for strain-specific detection of BGN4 in commercial products and fecal samples of animal models. The primer set was tested on seven strains of B. bifidum and 75 strains of the other Bifidobacterium species. The BGN4-specific regions were derived using megaBLAST against genome sequences of various B. bifidum databases and four sets of primers were designed. As a result, only BGN4 produced four PCR products simultaneously whereas the other strains did not. The PCR detection limit using BGN4-specific primer sets was $2.8{\times}10^1CFU/ml$ of BGN4. Those primer sets also detected and identified BGN4 in the probiotic products containing BNG4 and fecal samples from a BGN4-fed animal model with high specificity. Our results indicate that the PCR assay from this study is an efficient tool for the simple, rapid, and reliable identification of BGN4, for which probiotic strains are known.

• International Journal of Oral Biology
• /
• 제46권4호
• /
• pp.155-159
• /
• 2021

This study aimed to develop strain-specific polymerase chain reaction (PCR) primers to detect Fusobacterium hwasookii KCOM 1249^T, F. hwasookii KCOM 1253, F. hwasookii KCOM 1256, F. hwasookii KCOM 1258, and F. hwasookii KCOM 1268 on the basis of nucleotide sequences of a gene specific to each strain. The unique genes for each F. hwasookii strain were determined on the basis of their genome sequences using Roary. The strain-specific PCR primers based on each strain-specific gene were designed using PrimerSelect. The specificity of each PCR primer was determined using the genomic DNA of the 5 F. hwasookii strains and 25 strains of oral bacterial species. The detection limit and sensitivity of each strain-specific PCR primer pair were determined using the genomic DNA of each target strain. The results showed that the strain-specific PCR primers correspond to F. hwasookii KCOM 1249^T, F. hwasookii KCOM 1253, F. hwasookii KCOM 1258, F. hwasookii KCOM 1256/F. nucleatum subsp. polymorphum KCOM 1260, or F. hwasookii KCOM 1268/Fusobacterium sp. oral taxon 203 were developed. The detection limits of these strain-specific PCR primers ranged from 0.2 to 2 ng of genomic DNA for each target strain. The results suggest that these strain-specific PCR primers are valuable in quality control for detecting specific F. hwasookii strains.

• Journal of Microbiology
• /
• 제39권1호
• /
• pp.56-61
• /
• 2001

Plasmodiophora brassicae is an obligate parasite, a causal organism of clubroot disease in crucifers that can survive in the soil as resting spores for many years. P. brassicae causes great losses in susceptible varieties of crucifers throughout the world. In this present study, an in planta molecular marker for the detection of P. bassicae was developed using an oligonucleotide primer set foam the small subunit gene (18S like) and internal transcribed spacer (ITS) region of rDNA. The specific primer sequences determined were TCAGCTTGAATGCTAATGTG (ITS5) and CTACCTCATTTGAGATCCTTTGA (PB-2). This primer set was used to specifically detect p. bassicae in planta. The amplicon using the specific primer set was about 1,000 bp. However, the test plant and other soil-borne fungi including Fusarium spp. and Rhizoctonia app., as well as bacteria such as Pseudomonas app. and Erwinia sup. did not show any reaction with the primer set.

• 식물병연구
• /
• 제18권2호
• /
• pp.73-79
• /
• 2012

Phytophthora katsurae는 밤나무 잉크병의 원인이 되는 병원성 균류이다. P. katsurae를 검출하기 위하여 2개의 duplex PCR primer set을 제작하였다(SOPC 1F/1R+KatI 3F/5R, SOPC 1-1F/1-1R+KatI 3F/5R). SOPC 1F/1R과 SOPC 1-1F/1-1R primer pair는 sequence characteristic amplification regions(SCAR)를 이용하여 제작하였고, KatI 3F/5R primer pair는 internal transcribed spacer(ITS) 부위로부터 제작하였다. 추출한 genomic DNA를 1 mg/ml에서 1 ng/ml까지 10배씩 순차적으로 희석하여 균사량에 따른 Duplex PCR의 민감도를 확인한 결과, 2개의 primer set은 각각 1 ${\mu}g/ml$와 100 ng/ml까지 검출이 가능하였다. 유주포자를 $1{\times}10^6$부터 $1{\times}10^2$ cells/ml까지 10배씩 순차적으로 희석하고 genomic DNA를 추출하여 P. katsurae의 유주포자량에 의한 검출 한계를 확인한 결과, 2개의 primer set 모두 $1{\times}10^5$ cells/ml까지 검출할 수 있었다. 각각의 primer set은 PCR 검출을 실시하였을 때 P. katsurae 균주에서만 PCR 산물이 증폭된 반면에, Phytophthora 16종에서는 P. katsurae에 특이적인 PCR 증폭산물이 생성되지 않았다. 따라서, 2개의 primer set을 이용한 Duplex PCR은 P. katsurae의 신속하고 효과적인 검출에 유용하게 활용될 수 있을 것이다.

• 미생물학회지
• /
• 제39권1호
• /
• pp.36-39
• /
• 2003

본 연구에서는 16S rDNA복합중합효소연쇄반응을 이용하여 중이 삼출액에서 미생물병인원에 대한 특성을 알아보았다. 중이염환자의 중이 삼출액에서의 미생물 병인원은 주로 streptococcus pneumoniae, Haemophilus influenzae와 Moraxella catarrhalis이다. 26명의 환자로부터 39개의 중이염의 삼출액을 얻었고, 중이 삼출액에서 DNA를 추출하였다. PCR은 16S rDNA의 C4 region에서 21 base pair의 common primer와 각각 bacterium specific primers [(i) Haemophilus-specific primer (ii) Moraxella-specific primer and (iii) Streptococcus-specific primer]를 이용하여 수행하였다. 39 개의 중이염의 삼출액 시료 중에서, H. influenzae가 24 개(61.5%) 검출되었고, M. catarrhalis는 10 개(25.6%), S.pneumoniae는 3개 (7.7%)가 검출되었다. 16s rDNA 복합중합효소연쇄 반응 진단 결과,11 개(28%)의 중이삼출액 시료에서 음성을 나타내었다. 중이염의 중복감염은 9개의 중이 삼출액시료에서 관찰되었고, 이들은 모두 H.influenzae 와 M. catarrhalis 에 의한 중복감염이었다. 본 연구에서 저자 등은 165 rDNA 복합중합효소연쇄반응이 병원성 미생물을 빠르게 진단하고, 중이삼출액의 미생물 병인론을 추적할 수 있는 좋은 방법으로 제시하는 바이다.

• The Plant Pathology Journal
• /
• 제29권1호
• /
• pp.99-104
• /
• 2013

To detect five plant viruses (Beet black scorch virus, Beet necrotic yellow vein virus, Eggplant mottled dwarf virus, Pelargonium zonate spot virus, and Rice yellow mottle virus) for quarantine purposes, we designed 15 RT-PCR primer sets. Primer design was based on the nucleotide sequence of the coat protein gene, which is highly conserved within species. All but one primer set successfully amplified the targets, and gradient PCRs indicated that the optimal temperature for the 14 useful primer sets was $51.9^{\circ}C$. Some primer sets worked well regardless of annealing temperature while others required a very specific annealing temperature. A primer specificity test using plant total RNAs and cDNAs of other plant virus-infected samples demonstrated that the designed primer sets were highly specific and generated reproducible results. The newly developed RT-PCR primer sets would be useful for quarantine inspections aimed at preventing the entry of exotic plant viruses into Korea.

• The Plant Pathology Journal
• /
• 제21권1호
• /
• pp.55-58
• /
• 2005

In order to diagnose and differentiate jujube witches' broom (JWB) phytoplasma rapidly, oligonucleotide primer pair, 16Sr(V) F/R, for polymerase chain reactions (PCRs) was designed on the basis of 16S rRNA sequences of JWB phytoplasma. The PCR employing phytoplasma universal primer pair P1/P7 consistently amplified DNA in all tested phytoplasma isolates. But no phytoplasma DNA was detected from healthy jujube seedlings. The nested PCR, the primer pair 16S(V) F/R, about 460 bp fragment, amplified DNA in all tested JWB and related phytoplasmas including ligustrum witches' broom phytoplasma of the 16S rRNA group V, but no DNA amplification was detected from other phytoplasma strains such as groups 16SrI (Aster yellows) and 16SrXII (Stolbur group) in which mulberry dwarf phytoplasma and chrysanthemum witches' broom phytoplasma belong to, respectively. The same results were obtained from both Korean and Chinese isolates of JWB phytoplasma. Nested-PCR using phytoplasma universal primer pair P1/P7 and 16SrV group-specific primer pair 16S(V) F/R could detect group V phytoplasmas rapidly and easily, in particular JWB phytoplasma.

• Mycobiology
• /
• 제31권1호
• /
• pp.23-31
• /
• 2003

With universal primer ITS1-F, the specific DHJ2 primer was developed to detect the Ectomycorrhizal(ECM) root tips in soil and to identify the species of ECM fungi, as based on DNA sequences of rDNA stored in GeneBank of NCBI. This primer was designed with the common sites of rDNA of Amanita and Boletus, and was also designed with several DNA programs provided by NCBI. The DNA fragments synthesized by PCR were calculated to be 1,000 to 1,200 bps of DNA located to 18s to 28s rDNA to contain two variable sites of ITS, indicating much diversities for specific species or ecotypes of ECM fungi. The primer DHJ2 reacted with the genomic DNA's extracted from the tissues of basidiocarp at the rate of 73 of 80 fungi collected produced single bands with a 1,100 bps length. The DNA fragment synthesized with the genomic DNA that extracted from eight ECM tips of Pinus densiflora was confirmed and analysized to the rDNAs of ECM in full sequences, and informed to be a ECM fungal species in the forest.