• Journal of Microbiology and Biotechnology
• /
• 제30권2호
• /
• pp.216-225
• /
• 2020

An esterase gene, estA1, was cloned from Alteromonas sp. 39-G1 isolated from the Beaufort Sea. The gene is composed of 1,140 nucleotides and codes for a 41,190 Da protein containing 379 amino acids. As a result of a BLAST search, the protein sequence of esterase EstA1 was found to be identical to Alteromonas sp. esterase (GenBank: PHS53692). As far as we know, no research on this enzyme has yet been conducted. Phylogenetic analysis showed that esterase EstA1 was a member of the bacterial lipolytic enzyme family IV (hormone sensitive lipases). Two deletion mutants (Δ20 and Δ54) of the esterase EstA1 were produced in Escherichia coli BL21 (DE3) cells with part of the N-terminal of the protein removed and His-tag attached to the C-terminal. These enzymes exhibited the highest activity toward p-nitrophenyl (pNP) acetate (C₂) and had little or no activity towards pNP-esters with acyl chains longer than C₆. Their optimum temperature and pH of the catalytic activity were 45℃ and pH 8.0, respectively. As the NaCl concentration increased, their enzyme activities continued to increase and the highest enzyme activities were measured in 5 M NaCl. These enzymes were found to be stable for up to 8 h in the concentration of 3-5 M NaCl. Moreover, they have been found to be stable for various metal ions, detergents and organic solvents. These salt-tolerant and chemical-resistant properties suggest that the enzyme esterase EstA1 is both academically and industrially useful.

• Journal of Microbiology and Biotechnology
• /
• 제20권1호
• /
• pp.45-53
• /
• 2010

We have developed an efficient and precise method for genome manipulations in Bacillus subtilis that allows rapid alteration of a gene sequence or multiple gene sequences without altering the chromosome in any other way. In our approach, the Escherichia coli toxin gene mazF, which was used as a counter-selectable marker, was placed under the control of a xylose-inducible expression system and associated with an antibiotic resistance gene to create a "mazF-cassette". A polymerase chain reaction (PCR)-generated fragment, consisting of two homology regions joined to the mazF-cassette, was integrated into the chromosome at the target locus by homologous recombination, using positive selection for antibiotic resistance. Then, the excision of the mazF-cassette from the chromosome by a single-crossover event between two short directly repeated (DR) sequences, included in the design of the PCR products, was achieved by counter-selection of mazF. We used this method efficiently and precisely to deliver a point mutation, to inactivate a specific gene, to delete a large genomic region, and to generate the in-frame deletion with minimal polar effects in the same background.

• Journal of Microbiology and Biotechnology
• /
• 제24권8호
• /
• pp.1081-1087
• /
• 2014

Aspergillus oryzae is generally recognized as safe, but it is closely related to A. flavus in morphology and genetic characteristics. In this study, we tested the aflatoxigenicity and genetic analysis of nine commercial A. oryzae strains that were used in Korean soybean fermented products. Cultural and HPLC analyses showed that none of the commercial strains produced detectable amount of aflatoxins. According to the molecular analysis of 17 genes in the aflatoxin (AF) biosynthetic pathway, the commercial strains could be classified into three groups. The group I strains contained all the 17 AF biosynthetic genes tested in this study; the group II strains deleted nine AF biosynthetic genes and possessed eight genes, including aflG, aflI, aflK, aflL, aflM, aflO, aflP, and aflQ; the group III strains only had six AF biosynthetic genes, including aflG, aflI, aflK, aflO, aflP, and aflQ. With the reverse transcription polymerase chain reaction, the group I A. oryzae strains showed no expression of aflG, aflQ and/or aflM genes, which resulted in the lack of AF-producing ability. Group II and group III strains could not produce AF owing to the deletion of more than half of the AF biosynthetic genes. In addition, the sequence data of polyketide synthase A (pksA) of group I strains of A. oryzae showed that there were three point mutations (two silent mutations and one missense mutation) compared with aflatoxigenic A. flavus used as the positive control in this study.

• 미생물학회지
• /
• 제48권2호
• /
• pp.171-174
• /
• 2012

THOC1/Hpr1는 mRNA가 전사되는 동안 mRNP의 포장과 mRNA 방출에 관여하는 진화적으로 잘 보존된 THO 복합체의 한 소단위이다. 분열효모 Schizosaccharomyces pombe에서도 THOC1/Hpr1과 유사한 단백질을 암호화하는 유전자(sphpr1로 명명)를 찾아 그 특성을 조사하였다. 이배체 S. pombe 균주에 하나의 sphpr1 유전자만을 결실시킨 후 4분체 분석을 수행한 결과, 이 유전자는 생장에 필수적이었다. 티아민에 의해 발현이 조절되는 강력한 nmt1 프러모터를 이용하여 sphpr1를 과발현시키더라도 세포의 생장과 mRNA 방출에는 전혀 영향이 없었다. 하지만, sphpr1의 발현을 억제하면 생장이 억제되었으며 poly$(A)^+$ RNA가 핵 안에 축적되었다. 이와 같은 결과들은 sphpr1 유전자가 생장과 mRNA의 핵에서 세포질로의 방출에 관여하고 있음을 시사한다.

• Journal of the Korean Association of Oral and Maxillofacial Surgeons
• /
• 제35권1호
• /
• pp.1-6
• /
• 2009

DNA double-strand breaks (DSBs) occur commonly in the all living and in cycling cells. They constitute one of the most severe form of DNA damage, because they affect both strand of DNA. DSBs result in cell death or a genetic alterations including deletion, loss of heterozygosity, translocation, and chromosome loss. DSBs arise from endogenous sources like metabolic products and reactive oxygen, and also exogenous factors like ionizing radiation. Defective DNA DSBs can lead to toxicity and large scale sequence rearrangement that can cause cancer and promote premature aging. There are two major pathways for their repair: homologous recombination(HR) and non-homologous end-joining(NHEJ). The HR pathway is a known "error-free" repair mechanism, in which a homologous sister chromatid serves as a template. NHEJ, on the other hand, is a "error-prone" pathway, in which the two termini of the broken DNA molecule are used to form compatible ends that are directly ligated. This review aims to provide a fundamental understanding of how HR and NHEJ pathways operate, cause genome instability, and what kind of genes during the pathways are associated with head and neck cancer.

• Asian Pacific Journal of Cancer Prevention
• /
• 제16권11호
• /
• pp.4589-4592
• /
• 2015

Background: Missense and frame-shift mutations within the dimer forming domain of the caspase 8 gene have been identified in several cancers. However, the genetic status of this region in precancerous lesions, like oral submucous fibrosis (OSMF), and well differentiated oral squamous cell carcinomas (OSCCs) in patients from southern region of India is not known, and hence the present study was designed to address this issue. Materials and Methods: Genomic DNA isolated from biopsy tissues of thirty one oral submucous fibrosis and twenty five OSCC samples were subjected to PCR amplification with intronic primers flanking exon 7 of the caspase 8 gene. The PCR amplicons were subsequently subjected to direct sequencing to elucidate the status of mutation. Results: Sequence analysis identified a frame-shift and a novel missense mutation in two out of twenty five OSCC samples. The frame-shift mutation was due to a two base pair deletion (c.1225_1226delTG), while the missense mutation was due to substitution of wild type cysteine residue with phenylalanine at codon 426 (C426F). The missense mutation, however, was found to be heterozygous as the wild type C426C codon was also present. None of the OSMF samples carried mutations. Conclusions: The identification of mutations in OSCC lesions but not OSMF suggests that dimer forming domain mutations in caspase 8 may be limited to malignant lesions. The absence of mutations in OSMF also suggests that the samples analyzed in the present study may not have acquired transforming potential. To the best of our knowledge this is the first study to have explored and identified frame-shift and novel missense mutations in OSCC tissue samples.

• IMMUNE NETWORK
• /
• 제2권4호
• /
• pp.208-216
• /
• 2002

Background: Reactive oxygen and nitrogen are produced by rheumatoid arthritis (RA) synovial tissue and can induce mutations in key genes. Normally, this process is prevented by a DNA mismatch repair (MMR) system that maintains sequence fidelity. Key members of the MMR system include MutS${\alpha}$ (comprised of hMSH2 and hMSH6), which can sense and repair single base mismatches and 8-oxoguanine, and MutS${\beta}$ (comprised of hMSH2 and hMSH3), which repairs longer insertion/deletion loops. Methods: To provide further evidence of DNA damage, we analyzed synovial tissues for microsatellite instability (MSI). MSI was examined by PCR on genomic DNA of paired synovial tissue and peripheral blood cells (PBC) of RA patients using specific primer sequences for 5 key microsatellites. Results: Surprisingly, abundant MSI was observed in RA synovium compared with osteoarthritis (OA) tissue. Western blot analysis of the same tissues for the expression of MMR proteins demonstrated decreased hMSH6 and increased hMSH3 in RA synovium. To evaluate potential mechanisms of MMR regulation in arthritis, fibroblast-like synoviocytes (FLS) were isolated from synovial tissues and incubated with the nitric oxide donor S-nitroso-N-acetylpenicillamine (SNAP). Western blot analysis demonstrated constitutive expression of hMSH2, 3 and 6 in RA and OA FLS. When FLS were cultured with SNAP, the RA synovial pattern of MMR expression was reproduced (high hMSH3, low hMSH6). Conclusion: Therefore, oxidative stress can relax the DNA MMR system in RA by suppressing hMSH6. Decreased hMSH6 can subsequently interfere with repair of single base mutations, which is the type observed in RA. We propose that oxidative stress not only creates DNA adducts that are potentially mutagenic, but also suppresses the mechanisms that limit the DNA damage.

• BMB Reports
• /
• 제45권1호
• /
• pp.32-37
• /
• 2012

Alternative splicing generates several interleukin-6 (IL-6) isoforms; for them an antagonistic activity to the wild-type IL-6 has been proposed. In this study we quantified the relative abundance of IL-6 mRNA isoforms in a panel of mouse tissues and in C2C12 cells during myoblast differentiation or after treatment with the $Ca^{2+}$ ionophore A23187, the AMP-mimetic AICAR and TNF-${\alpha}$. The two mouse IL-6 isoforms identified, IL-6${\delta}$5 (deletion of the first 58 bp of exon 5) and IL-6${\delta}$3 (lacking exon 3), were not conserved in rat and human, did not exhibit tissue specific regulation, were expressed at low levels and their abundance closely correlated to that of full-length IL-6. Species-specific features of the IL-6 sequence, such as the presence of competitive 3' acceptor site in exon 5 and insertion of retrotransposable elements in intron 3, could explain the production of IL-6${\delta}$5 and IL-6${\delta}$3. Our results argued against biological significance for mouse IL-6 isoforms.

• 한국응용약물학회:학술대회논문집
• /
• 한국응용약물학회 2001년도 추계학술대회 및 정기총회
• /
• pp.108-108
• /
• 2001

Axin2/Conductin/Axil and its ortholog Axin are negative regulators of the Wnt signaling pathway, which promote the phosphorylation and degradation of ${\beta}$-catenin. While Axin is expressed ubiquitously, Axin2 mRNA was seen in a restricted pattern during mouse embryogenesis and organogenesis. Because many sites of Axin2 expression overlapped with those of several Wnt genes, we tested whether Axin2 was induced by Wnt signaling. Endogenous Axin2 mRNA and protein expression could be rapidly induced by activation of the Wnt pathway, and Axin2 reporter constructs, containing a 5.6 kb DNA fragment including the promoter and first intron, were also induced. This genomic region contains eight Tcf/LEF consensus binding sites, five of which are located within longer, highly conserved non-coding sequences. The mutation or deletion of these Tcf/LEF sites greatly diminished induction by ${\beta}$-catenin, and mutation of the Tcf/LEF site T2 abolished protein binding in an electrophoretic mobility-shift assay. These results strongly suggest that Axin2 is a direct target of the Wnt pathway, mediated through Tcf/LEF factors. The 5.6 kb genomic sequence was sufficient to direct the tissue specific expression of d2EGFP in transgenic embryos, consistent with a role for the Tcf/LEF sites and surrounding conserved sequences in the in vivo expression pattern of Axin2. Our results suggest that Axin2 participates in a negative feedback loop, which could serve to limit the duration or intensity of a Wnt-initiated signal.

• Journal of Plant Biology
• /
• 제35권2호
• /
• pp.155-163
• /
• 1992

식물세포에 tumor를 유발하는 Agrobacterium tumefaciens pTiA6 plasmid에서 virE 유전자의 발현조절기작을 분자적수준에서 규명하기 위하여 virE promoter의 5＇-말단을 제거하여 얻은 truncated virE 재조합플라스미드를 이용하여 virE promoter의 조절부위에 대하여 연구하였다. virE promoter의 기능이 존재하는 truncated virE 재조합플라스미드인 pJS201은 전기영동에 의하여 virE promoter의 5＇-말단으로부터 약 130개의 염기가 제거된 것으로 측정되었다. 한편 virE promoter의 기능을 상실한 pJS301에서 dideoxy chain termination방법으로 truncated virE promoter 염기서열을 결정한 결과 263개의 염기가 제거된 것으로 확인되었다. 따라서 virE promoter의 조절부위는 virE promoter의 5＇-말단으로부터 약 130번째의 염기에서 263번째의 염기사이에 존재하는 것으로 사료되며, 이 사이에 23개의 염기로 이루어진 역반복서열(AACTTTGCGCTATAGGCAAAGTT)이 존재하고 있는데, 이 부위가 virE operon의 발현에 있어서 RNA polymerase의 최초 인식부위(recognition site)일 것으로 사료된다.