• The Plant Pathology Journal
• /
• v.17 no.5
• /
• pp.257-263
• /
• 2001

Species of the genus Orobanche are parasitic flowering plants, holoparasites, which cling to the roots of green plants. Their tiny seeds (200 x $250\mu\textrm{m}$) germinate in response to chemical stimuli produced by host and some non-host plants. Successful contact with their host leads to development of haustoria for obtaining water and food. The shoots above the ground expose flowers and disseminate seeds. Several samples of Orobanche ramosa, O. crenata, O. cernua, and O. egyptiaca were collected from different localities in Jordan. These samples showed one of the following disease symptoms: dry rot at the base of the stem; general deterioration and expanded lesion from base upward; soft tissue maceration of stem; and black rot of flower parts with incomplete maturation of the ovary and seeds. Isolation from diseased stems and seeds was made on three different mycological media. Several fungi were isolated, mainly, Fusarium spp., Alternaria alternata, Rhizoctonia sp., Dendrophora sp., Chaetomium sp., and an ascomycetus fungus with a perithecium. Pathogenicity tests showed that Fusarium spp. and Alternaria alternata attacked healthy living tissue of Orobanche spikes. These fungi caused lesions of black soft rot and complete deterioration within 5-7 days. They also attacked Orobanche seeds, arresting their germination and causing maceration of non-germinated and germinated seeds after 5-7 days of incubation. Meanwhile, Dendrophora sp. and Chaetomium sp. caused limited lesion at first, but were able to colonize the tissue as it aged and senesced. This study showed the presence of a potential endogenous pathogenic fungi in Jordan, which can be investigated as a biological control for Orobanche.

• Journal of Microbiology
• /
• v.39 no.1
• /
• pp.56-61
• /
• 2001

Plasmodiophora brassicae is an obligate parasite, a causal organism of clubroot disease in crucifers that can survive in the soil as resting spores for many years. P. brassicae causes great losses in susceptible varieties of crucifers throughout the world. In this present study, an in planta molecular marker for the detection of P. bassicae was developed using an oligonucleotide primer set foam the small subunit gene (18S like) and internal transcribed spacer (ITS) region of rDNA. The specific primer sequences determined were TCAGCTTGAATGCTAATGTG (ITS5) and CTACCTCATTTGAGATCCTTTGA (PB-2). This primer set was used to specifically detect p. bassicae in planta. The amplicon using the specific primer set was about 1,000 bp. However, the test plant and other soil-borne fungi including Fusarium spp. and Rhizoctonia app., as well as bacteria such as Pseudomonas app. and Erwinia sup. did not show any reaction with the primer set.

• Journal of Applied Biological Chemistry
• /
• v.60 no.3
• /
• pp.213-218
• /
• 2017

The objective was to examine the antifungal activity of Pinus densiflora extract for the control of turfgrass fungal diseases. Antifungal activities of the various fractions of n-hexane, methylene chloride (Ch), ethyl acetate (EtOAc), and n-butanol from P. densiflora were evaluated against Rhizoctonia solani AG1-1B, R. solani AG2-2IV, Sclerotinia homoeocarpa, R. cerealis, Pythium spp., and Colletotrichum graminicola. The Ch and EtOAc fractions showed antifungal activity against Pythium sp. and C. graminicola in paper disc assay. The effective concentration to produce 50% mycelial inhibition ($EC_{50}$) using five discriminatory concentrations of pinosylvin (1) from the Ch fraction of P. densiflora was evaluated on R. solani AG1-1B, R. solani AG2-2IV, R. cerealis, and S. homoeocarpa. S. homoeocarpa showed the highest sensitivity with the lowest mean $EC_{50}$ value ($8.426{\mu}g/mL$) among the four pathogens. Among the three Rhizoctonia pathogens, R. cerealis had the highest mean $EC_{50}$ value ($99.832{\mu}g/mL$) and R. solani AG2-2IV, with the lowest sensitivity, had the lowest $EC_{50}$ value ($39.696{\mu}g/mL$). These results suggested that pinosylvin (1) from P. densiflora could be a valuable lead compound in the improvement of a novel antifungal agent.

• Research in Plant Disease
• /
• v.17 no.3
• /
• pp.280-287
• /
• 2011

This investigation was undertaken to survey toxigenic fungal contamination of various rice samples in 93 rice processing complexes (RPC) in Korea. Rice was grown in 2009 and the samples were collected in 2010. Seven types of rice samples such as unhusked, brown, blue-tinged, discolored, polished, half-crushed, and rice husks were obtained from each RPC. One-hundred and five grains of each sample were placed on PDA plates after surface disinfection. The incidence of fungal contaminants was 26.8%. Aspergillus spp. was the most dominant fungal contaminants and Fusarium spp. was the most frequently occurred in samples. The heaviest Fusarium contamination was found in unhusked grain, rice husks, and bare blue-tinged rice and followed by colored rice whereas broken rice was the least contaminated. Regional difference of fungal contamination was distinctive. Fusarium incidence in the rice samples from southern region of Korea including Jeolla and Gyeongsang Provinces was higher than those from central region including Chungcheong, Gyeonggi, and Gangwon Provinces. In contrast to Fusarium spp., Aspergillus spp. and Penicillium spp. were dominated in brown and polished rice samples and their incidences were more severe in central region than southern region. The major contaminants shown more than 1% of kernels infected were Aspergillus (5.0%), Fusarium (2.0%), Alternaria (1.4%), Dreschlera (1.3%), Penicillium spp. (1.3%), and Nigrospora spp. (1.0%). Collectotrichum, Pyricularia, Myrothecium, Epicoccum, Cladosporium, Moniliella, Gloeocercospora, Chaeto- mium, Curvularia, Phialopora, Acremonium, Gliomastix, Trichoderma, Rhizopus, Phomopsis, Paecilomyces, Genicularia, Geotrichum, Acremoniella, Rhizoctonia, Phoma, Oidiodendran, and Candida spp. were among the rest observed at low incidence. The major contaminants of rice samples were well-known as toxigenic fungal genera so toxin producibility of these fungal isolates is necessary to be examined in future. It is also needed to study Myrothecium spp. on species level as it was detected for the first time in rice.

• The Korean Journal of Pesticide Science
• /
• v.2 no.3
• /
• pp.28-35
• /
• 1998

An antimicrobial peptide producing bacterium, Bacillus subtilis A405, was screened and identified among 700 of antagonistic bacteria. The heat-resistant antimicrobial peptide, AMP-405, was purified from the broth culture of B. subtilis A405 through $20{\sim}40%$ ammonium sulfate precipitation and ultrafiltration. The AMP-405 exhibited strong antimicrobial activities against Botrytis cinerea, Cercospora sp., Fusarium oxysporum, Penicillium digitatum, Celletotrichum gloeosporioides, Rhizoctonia solani, Pythium ultimum, Pyricularia oryzae, Escherichia coli, Pseudomonas spp. and Candida albicans. The molecular weight of the peptide was about 3.0 kDa determined by SDS-PAGE, Native-PAGE and Tris-Tricine gradient electrophoresis, and composed of 9 kinds of amino acid such as aspartic acid, glycine, serine, glutamine, valine, leucine, isoleucine, proline, tyrocine. To determine the efficiency of AMP-405 as a potential maintenance of fruits freshness, cherry tomato was srored at $25^{\circ}C$ for 2 weeks after treatment with $50{\mu}g/ml$ of AMP-405 and $10^{5}$ spores/ml of Botrytis cinerea simultaneously. Treatment with AMP-405 resulted in significantly less infection by Botrytis cinerea, than the treatment with tap water as a control.

• Korean Journal of Organic Agriculture
• /
• v.22 no.1
• /
• pp.129-145
• /
• 2014

To evaluate the potential of Hypochoeris radicata L. for the development of environment-friendly organic materials, its growth characteristics, allelopathic effects and antifungal activity was investigated. The growth characteristics of H. radicata L. was investigated by measuring comparative number of shoot and flower, and the diameters of clones in mowing areas and non-mowing areas, respectively. As a result, the number of shoot and flower, and diameters of clones of H. radicata L. grown in mowing areas were much higher than those grown in non-mowing areas. Water extracts of H. radicata L. inhibited seed germination, and shoot, root and root hair growth of 14 test plants including Trifolium pratense, Festuca myuros, Bidens bipinnata and finally reduced heir biomass remarkably. The inhibitory effect of the extract was different depending on the kind and the part of tested plants. The extracts showed high antifungal activity against Pythium spp. and Phytophthora However, it showed comparably less antifungal activity against Rhizoctonia solani than Pythium spp. and Phytophthora. In conclusion, cutting H. radicata L. resulted increase of its vegetative and seed propagation and helped it to form large colony. Also it had an effect on growth of microbes and germination and growth of other plants. Therefore H. radicata L. holds the competitive dominant position in plant ecosystem in Jeju Island and it can be used as candidate of environment-friendly organic materials.

• Korean Journal of Soil Science and Fertilizer
• /
• v.25 no.1
• /
• pp.70-76
• /
• 1992

A field experiment was conducted to find out the influence of cropping systems under rotation of paddy-upland soil on soil microorganisms with specific reference to cations concentration in the soil. The results obtained was summarized as follows. 1. The number of soil bacteria and actinomycetes increased in fallow, continuous cultivation of rice and soybean while the number of fungi decreased. 2. Gram negative bacteria as Pseudomonas spp. and Rhizobium spp. remarkably incerased with increasing Gram positive bacteria of Bacillus subtilis in continuous cultivatio of soybean. 3. The relative population of soil born plant pathogen such as Fusarium spp. Rhizoctionia spp. and Phoma spp. to the total soil fungi was high in cultivation of potato and Chinese cabbage. The ratio of soil plant pathogen to the total soil fungi was high in cultivation of potato with Chinese cabbage. 4. The number of bacteria and actinomycetes was positively correlated with ratio of Ca＋Mg/K in soil while negatively correlated with soil fungi.

• Korean journal of applied entomology
• /
• v.26 no.2 s.71
• /
• pp.89-97
• /
• 1987

Antagonistic microorganisms from rhizosphere soil were isolated, identified, and applied successfully as the biocontrol agents of damping-off caused by Rhizoctonia spp. Rhizosphere antagonists isolated from rhizosphere soil were identified as Trichoderma viride, T. harzianum, T. hamatum, T. polysporum, Gliocladium sp., Pseudomonas fluorescence, P. stutzeri, P. cepacia, Enterobacter sp., Serratia sp. and Erwinia herbicola. Of these, the most promising ones in vitro were T. virdie, T. harzianum, Gliocladium sp., Serratia sp., P. stutzeri, and P. cepacia. These above six antagonists were efficient in reducing disease incidence to $40{\sim}70%$ when the reselected rhizosphere antagonists preparations were applied to the soil at $10^6$ propagules per gram. Among six antagonists, T. viride was the most promising biocontrol agents against R. solani isolates in soil. The suppressive effect was more evident in steam-sterilized soil than in non-sterilized field soil.

• International Journal of Industrial Entomology and Biomaterials
• /
• v.31 no.2
• /
• pp.107-114
• /
• 2015

Endophytes provide multifarious benefits such as promotion of plant growth and yield, suppression of phyto-pathogens, phosphate solubilising and fixation nitrogen. A study has been carried out to explore growth promotion and antifungal activities of endophytes of mulberry (Morus spp.). Endophytic bacteria were isolated from mulberry plants and studied their cultural, morphological characters, growth promotion as well as their antifungal activity against Rhizoctonia bataticola and Fusarium oxysporum , two mulberry root rot associated pathogens. Except two isolates, all bacteria were colourless and the colony size of eight isolates was small. The margin of five isolates was irregular and the consistency of three isolates was creamy, six isolates was slimy and one was mucoid. Texture of seven isolates was convex and others were flat. Eight isolates were gram positive and the rest Gram negative, five were cocci and others were bacilli (rod shaped). Four isolates were motile and all were catalase positive and only three isolates were oxidase positive. Spore staining was positive only for two isolates. The growth promotion study showed that there was significant difference in root length and seedling length. The antagonistic effect of the bacterial isolates was tested against R. bataticola showed significant (p <0.05) influence of the bacteria, days after inoculation and their interaction on the inhibition of fungal growth. The isolate En-7 completely inhibited the fungus followed by En-5 (66.67%). The bacterial isolates significantly (p <0.05) inhibited growth of F. oxysporum in PDA. The mean inhibition was higher (70.45%) in case of En-7 followed by En-8 (68.65%) and En-10 (66.44%). The study reveals that some endophytic bacteria associated with mulberry have growth promotion and antifungal activity and could be explored for promotion of mulberry growth and managing root rot disease.

• Korean Journal of Environmental Agriculture
• /
• v.31 no.1
• /
• pp.68-74
• /
• 2012

BACKGROUND: Some microorganisms extant in nature have ability to suppress various plant pathogens, and also can promote plant growth. Thus microorganisms are such great source of antimicrobial agents to develop antagonistic microorganism production and eco-friendly crop management. We isolated the microorganisms in various eco-friendly formulations. The suppressive abilities against plant pathogens have been characterized in vitro level. METHODS AND RESULTS: The indigenous microorganisms have been isolated from Cooked rice, Black sugar, Rice Bran, and Red clay using dilution plating method. Population of bacteria and fungi were above 107 in the all formulations. We isolated and pure cultured the microorganisms based on morphological characteristics. Three major plant pathogens (Fusarium oxysporum, Rhizoctonia solani, Phytophthora capsici) have been used to select antagonistic microorganisms. Total 20 bacteria and 9 fungi showed the pathogen growth suppression ability in vitro condition. The selected microorganisms were identified by ITS sequence similarity. CONCLUSION: All tested eco-friendly formulations contained high-density of the microorganisms. Among the isolated microorganisms, Bacillus spp. and Streptomyces spp. showed the most effective antifungal activity against the plant pathogens such as F. oxysporum, R. solani, and P. capsici. Among the selected fungi Trichoderma sp. demonstrated antifungal activity. Our results suggest that the currently adapted eco-friendly formulations might useful for sustain agricultural system.